FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632654_at:

>probe:Drosophila_2:1632654_at:237:281; Interrogation_Position=109; Antisense; CTGAAAACGATCATAGCCCGCTACC
>probe:Drosophila_2:1632654_at:402:671; Interrogation_Position=130; Antisense; TACCCGGAGGTGGATTTCTGTGGCT
>probe:Drosophila_2:1632654_at:128:19; Interrogation_Position=143; Antisense; ATTTCTGTGGCTACACGATTCCGCA
>probe:Drosophila_2:1632654_at:180:463; Interrogation_Position=159; Antisense; GATTCCGCATCCCACGGAGCAGAAG
>probe:Drosophila_2:1632654_at:356:149; Interrogation_Position=188; Antisense; ACTTCCGCATTCAATCCCGTCGAGA
>probe:Drosophila_2:1632654_at:585:633; Interrogation_Position=202; Antisense; TCCCGTCGAGACAGAGCCATAGATA
>probe:Drosophila_2:1632654_at:437:641; Interrogation_Position=249; Antisense; TCTGGAGGGTCTGTGTGATCATACA
>probe:Drosophila_2:1632654_at:416:265; Interrogation_Position=26; Antisense; CAGAGCTGGCTGGTGATGAGAAAAA
>probe:Drosophila_2:1632654_at:670:513; Interrogation_Position=263; Antisense; GTGATCATACAATCGTTACGTTCGA
>probe:Drosophila_2:1632654_at:235:439; Interrogation_Position=294; Antisense; GATGGCCGAGTTTAATGCAATGAAA
>probe:Drosophila_2:1632654_at:590:387; Interrogation_Position=45; Antisense; GAAAAACGGCGAAGGATCTCGTACT
>probe:Drosophila_2:1632654_at:628:77; Interrogation_Position=57; Antisense; AGGATCTCGTACTTTTGTGTTCACC
>probe:Drosophila_2:1632654_at:240:701; Interrogation_Position=69; Antisense; TTTTGTGTTCACCAACGAGGGCCAC
>probe:Drosophila_2:1632654_at:16:197; Interrogation_Position=82; Antisense; AACGAGGGCCACACGCTGGGAAATG

Paste this into a BLAST search page for me
CTGAAAACGATCATAGCCCGCTACCTACCCGGAGGTGGATTTCTGTGGCTATTTCTGTGGCTACACGATTCCGCAGATTCCGCATCCCACGGAGCAGAAGACTTCCGCATTCAATCCCGTCGAGATCCCGTCGAGACAGAGCCATAGATATCTGGAGGGTCTGTGTGATCATACACAGAGCTGGCTGGTGATGAGAAAAAGTGATCATACAATCGTTACGTTCGAGATGGCCGAGTTTAATGCAATGAAAGAAAAACGGCGAAGGATCTCGTACTAGGATCTCGTACTTTTGTGTTCACCTTTTGTGTTCACCAACGAGGGCCACAACGAGGGCCACACGCTGGGAAATG

Full Affymetrix probeset data:

Annotations for 1632654_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720