FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632656_at:

>probe:Drosophila_2:1632656_at:578:683; Interrogation_Position=1028; Antisense; TATGCCTCGTTTTCTTTATATGATT
>probe:Drosophila_2:1632656_at:295:459; Interrogation_Position=1101; Antisense; GATATTAGCATTATCACTCTTGTGA
>probe:Drosophila_2:1632656_at:432:353; Interrogation_Position=534; Antisense; GCACCATAAGACTCATTTTCTCCGA
>probe:Drosophila_2:1632656_at:525:437; Interrogation_Position=557; Antisense; GAGGACATCCTTCTGAACTACAATA
>probe:Drosophila_2:1632656_at:497:189; Interrogation_Position=621; Antisense; AACATCTGTTTCGTTCGCTTATGAA
>probe:Drosophila_2:1632656_at:575:339; Interrogation_Position=637; Antisense; GCTTATGAACGCCATCGGTCAGGTG
>probe:Drosophila_2:1632656_at:649:535; Interrogation_Position=653; Antisense; GGTCAGGTGGAACCGACGCTACCCT
>probe:Drosophila_2:1632656_at:641:77; Interrogation_Position=741; Antisense; AGGTAGATGATGACCCCTTGTCCGT
>probe:Drosophila_2:1632656_at:162:299; Interrogation_Position=755; Antisense; CCCTTGTCCGTTTTGAGCGTGGAGA
>probe:Drosophila_2:1632656_at:369:327; Interrogation_Position=771; Antisense; GCGTGGAGAAATCATAACTGTGCCC
>probe:Drosophila_2:1632656_at:538:31; Interrogation_Position=784; Antisense; ATAACTGTGCCCATGTGAGATGACA
>probe:Drosophila_2:1632656_at:185:459; Interrogation_Position=840; Antisense; GATTTACGGGCGAATCAATCCGAAT
>probe:Drosophila_2:1632656_at:378:65; Interrogation_Position=892; Antisense; ATGGATCATCATCACTTTGTTGAGA
>probe:Drosophila_2:1632656_at:573:683; Interrogation_Position=988; Antisense; TATCGATGTTTCACGCCTTCAAAGT

Paste this into a BLAST search page for me
TATGCCTCGTTTTCTTTATATGATTGATATTAGCATTATCACTCTTGTGAGCACCATAAGACTCATTTTCTCCGAGAGGACATCCTTCTGAACTACAATAAACATCTGTTTCGTTCGCTTATGAAGCTTATGAACGCCATCGGTCAGGTGGGTCAGGTGGAACCGACGCTACCCTAGGTAGATGATGACCCCTTGTCCGTCCCTTGTCCGTTTTGAGCGTGGAGAGCGTGGAGAAATCATAACTGTGCCCATAACTGTGCCCATGTGAGATGACAGATTTACGGGCGAATCAATCCGAATATGGATCATCATCACTTTGTTGAGATATCGATGTTTCACGCCTTCAAAGT

Full Affymetrix probeset data:

Annotations for 1632656_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720