FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632657_at:

>probe:Drosophila_2:1632657_at:168:207; Interrogation_Position=1009; Antisense; AAGCTGTTGTATCGCCGTTTGTTGA
>probe:Drosophila_2:1632657_at:76:445; Interrogation_Position=1032; Antisense; GATGAATGAAACCTACCAGCACCCT
>probe:Drosophila_2:1632657_at:459:429; Interrogation_Position=1069; Antisense; GAGTATCATATCAAGCCAACGCCAA
>probe:Drosophila_2:1632657_at:647:65; Interrogation_Position=1103; Antisense; ATGGATCCCACTTTCTAATGTCGTA
>probe:Drosophila_2:1632657_at:191:191; Interrogation_Position=1138; Antisense; AACTTGGAACACAACGCTGTCTATG
>probe:Drosophila_2:1632657_at:229:107; Interrogation_Position=653; Antisense; AGAAATCTTGGGTCCACGCATCTGA
>probe:Drosophila_2:1632657_at:681:595; Interrogation_Position=687; Antisense; TGTGGAGCTCGTTTGCATAGTTCAT
>probe:Drosophila_2:1632657_at:432:333; Interrogation_Position=732; Antisense; GCTGTGGTACCAGAACTCATTTCTA
>probe:Drosophila_2:1632657_at:220:715; Interrogation_Position=752; Antisense; TTCTACTTGATGCTACCGATCGGAG
>probe:Drosophila_2:1632657_at:298:535; Interrogation_Position=800; Antisense; GGTACAGCCTGATTATCCGGAACTT
>probe:Drosophila_2:1632657_at:218:385; Interrogation_Position=819; Antisense; GAACTTCCAGCCAACGGATTTCGGA
>probe:Drosophila_2:1632657_at:61:23; Interrogation_Position=928; Antisense; ATATCTCCCGCGTTGAGTGGATTCC
>probe:Drosophila_2:1632657_at:534:519; Interrogation_Position=944; Antisense; GTGGATTCCTAGATCACTACAACTT
>probe:Drosophila_2:1632657_at:362:247; Interrogation_Position=978; Antisense; AATTGAGTCAATACCGCCGCTTGAT

Paste this into a BLAST search page for me
AAGCTGTTGTATCGCCGTTTGTTGAGATGAATGAAACCTACCAGCACCCTGAGTATCATATCAAGCCAACGCCAAATGGATCCCACTTTCTAATGTCGTAAACTTGGAACACAACGCTGTCTATGAGAAATCTTGGGTCCACGCATCTGATGTGGAGCTCGTTTGCATAGTTCATGCTGTGGTACCAGAACTCATTTCTATTCTACTTGATGCTACCGATCGGAGGGTACAGCCTGATTATCCGGAACTTGAACTTCCAGCCAACGGATTTCGGAATATCTCCCGCGTTGAGTGGATTCCGTGGATTCCTAGATCACTACAACTTAATTGAGTCAATACCGCCGCTTGAT

Full Affymetrix probeset data:

Annotations for 1632657_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720