FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632659_at:

>probe:Drosophila_2:1632659_at:120:551; Interrogation_Position=3090; Antisense; GGAGATATTCGCGTACTGTGTTTTC
>probe:Drosophila_2:1632659_at:615:513; Interrogation_Position=3107; Antisense; GTGTTTTCTACATCTACTACGAGCA
>probe:Drosophila_2:1632659_at:218:427; Interrogation_Position=3149; Antisense; GAGATGCAATGTTTTCGCTAGGAAT
>probe:Drosophila_2:1632659_at:579:277; Interrogation_Position=3166; Antisense; CTAGGAATGTCCTTGGTGGCCATAT
>probe:Drosophila_2:1632659_at:709:521; Interrogation_Position=3181; Antisense; GTGGCCATATTCTTGGTCACTCTAT
>probe:Drosophila_2:1632659_at:134:495; Interrogation_Position=3196; Antisense; GTCACTCTATTGATCACTGGTCTGG
>probe:Drosophila_2:1632659_at:504:499; Interrogation_Position=3215; Antisense; GTCTGGACATCACATCAACGTTCAT
>probe:Drosophila_2:1632659_at:42:43; Interrogation_Position=3238; Antisense; ATCGTTCTCTTCATGGTGATCTGCA
>probe:Drosophila_2:1632659_at:22:563; Interrogation_Position=3442; Antisense; GGAAGTAGTGTCCTCTCCGGCATAA
>probe:Drosophila_2:1632659_at:54:571; Interrogation_Position=3460; Antisense; GGCATAACTCTCACCAAATTCGCGG
>probe:Drosophila_2:1632659_at:264:163; Interrogation_Position=3475; Antisense; AAATTCGCGGGCATCGTTGTCCTGG
>probe:Drosophila_2:1632659_at:548:145; Interrogation_Position=3515; Antisense; AAATCTTCCAGGTGTTCTACTTCCG
>probe:Drosophila_2:1632659_at:180:645; Interrogation_Position=3530; Antisense; TCTACTTCCGGATGTATCTGGGCAT
>probe:Drosophila_2:1632659_at:518:5; Interrogation_Position=3553; Antisense; ATTGTCCTTATTGGAGCAGCCCACG

Paste this into a BLAST search page for me
GGAGATATTCGCGTACTGTGTTTTCGTGTTTTCTACATCTACTACGAGCAGAGATGCAATGTTTTCGCTAGGAATCTAGGAATGTCCTTGGTGGCCATATGTGGCCATATTCTTGGTCACTCTATGTCACTCTATTGATCACTGGTCTGGGTCTGGACATCACATCAACGTTCATATCGTTCTCTTCATGGTGATCTGCAGGAAGTAGTGTCCTCTCCGGCATAAGGCATAACTCTCACCAAATTCGCGGAAATTCGCGGGCATCGTTGTCCTGGAAATCTTCCAGGTGTTCTACTTCCGTCTACTTCCGGATGTATCTGGGCATATTGTCCTTATTGGAGCAGCCCACG

Full Affymetrix probeset data:

Annotations for 1632659_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720