FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632660_at:

>probe:Drosophila_2:1632660_at:349:681; Interrogation_Position=296; Antisense; TATGGCTTGATCCATGCTCGCTTTA
>probe:Drosophila_2:1632660_at:625:335; Interrogation_Position=311; Antisense; GCTCGCTTTATCCTAACCAACAGGG
>probe:Drosophila_2:1632660_at:314:523; Interrogation_Position=367; Antisense; GGGCGAATTCGGCACATGTCCACGT
>probe:Drosophila_2:1632660_at:35:63; Interrogation_Position=382; Antisense; ATGTCCACGTGCATTCTGCCATAGC
>probe:Drosophila_2:1632660_at:334:25; Interrogation_Position=450; Antisense; ATATGGTACGCATCTATTGCCCCAA
>probe:Drosophila_2:1632660_at:280:7; Interrogation_Position=491; Antisense; ATTCCCAAGGCGTCGAGACATTCGA
>probe:Drosophila_2:1632660_at:386:441; Interrogation_Position=521; Antisense; GATGGAGCCTTCTTTGGCACTGGAT
>probe:Drosophila_2:1632660_at:267:143; Interrogation_Position=539; Antisense; ACTGGATTCCCTCATATGTTCTTTA
>probe:Drosophila_2:1632660_at:227:539; Interrogation_Position=565; Antisense; GGAGAAACCGGATGCTAGGCCCAAG
>probe:Drosophila_2:1632660_at:463:597; Interrogation_Position=607; Antisense; TGTGCCCAGGCTTTATGGCTTTAAA
>probe:Drosophila_2:1632660_at:9:293; Interrogation_Position=650; Antisense; CGTACTGCCGCTGAGATCCAAAAAG
>probe:Drosophila_2:1632660_at:452:423; Interrogation_Position=696; Antisense; GAGAAATCGATAGCCCATCCCACAT
>probe:Drosophila_2:1632660_at:47:255; Interrogation_Position=750; Antisense; CAACTGTCGCGTACTTCTCGAATAA
>probe:Drosophila_2:1632660_at:144:283; Interrogation_Position=798; Antisense; CTGCCAGCTCATTAAACTCTCATAA

Paste this into a BLAST search page for me
TATGGCTTGATCCATGCTCGCTTTAGCTCGCTTTATCCTAACCAACAGGGGGGCGAATTCGGCACATGTCCACGTATGTCCACGTGCATTCTGCCATAGCATATGGTACGCATCTATTGCCCCAAATTCCCAAGGCGTCGAGACATTCGAGATGGAGCCTTCTTTGGCACTGGATACTGGATTCCCTCATATGTTCTTTAGGAGAAACCGGATGCTAGGCCCAAGTGTGCCCAGGCTTTATGGCTTTAAACGTACTGCCGCTGAGATCCAAAAAGGAGAAATCGATAGCCCATCCCACATCAACTGTCGCGTACTTCTCGAATAACTGCCAGCTCATTAAACTCTCATAA

Full Affymetrix probeset data:

Annotations for 1632660_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720