FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632662_at:

>probe:Drosophila_2:1632662_at:556:255; Interrogation_Position=161; Antisense; CAAAAGGTCCTAGCACAGCAGATAG
>probe:Drosophila_2:1632662_at:102:79; Interrogation_Position=184; Antisense; AGGTTCAAGGACATGGCCACCACGG
>probe:Drosophila_2:1632662_at:282:115; Interrogation_Position=222; Antisense; AGCAGGATCAGCTGTGGGCCACGCT
>probe:Drosophila_2:1632662_at:475:565; Interrogation_Position=250; Antisense; GGCGCAGGACTCACGGGAATGTTCC
>probe:Drosophila_2:1632662_at:473:231; Interrogation_Position=267; Antisense; AATGTTCCAGGGACGTGGTCAGGCA
>probe:Drosophila_2:1632662_at:463:75; Interrogation_Position=317; Antisense; AGGAGGGATCCTTGGCAGCTTCAGC
>probe:Drosophila_2:1632662_at:258:353; Interrogation_Position=331; Antisense; GCAGCTTCAGCTTCGCAATCAGTAC
>probe:Drosophila_2:1632662_at:555:647; Interrogation_Position=349; Antisense; TCAGTACCGAAACCTCAACTAGTGG
>probe:Drosophila_2:1632662_at:261:193; Interrogation_Position=365; Antisense; AACTAGTGGAGGATGGTCCCTGCGC
>probe:Drosophila_2:1632662_at:218:73; Interrogation_Position=400; Antisense; AGGCAGTTCCTCAAGTGCACCGAGG
>probe:Drosophila_2:1632662_at:479:559; Interrogation_Position=423; Antisense; GGACAACAGCAGTGATCTCTCCGTT
>probe:Drosophila_2:1632662_at:255:73; Interrogation_Position=452; Antisense; AGGAGTTTAACGAGGCAATGCAGCA
>probe:Drosophila_2:1632662_at:301:233; Interrogation_Position=468; Antisense; AATGCAGCAGTGTCGGCGGCGCTAT
>probe:Drosophila_2:1632662_at:8:175; Interrogation_Position=54; Antisense; AAAGCCGTCTCGTGGGAGCAGCAAG

Paste this into a BLAST search page for me
CAAAAGGTCCTAGCACAGCAGATAGAGGTTCAAGGACATGGCCACCACGGAGCAGGATCAGCTGTGGGCCACGCTGGCGCAGGACTCACGGGAATGTTCCAATGTTCCAGGGACGTGGTCAGGCAAGGAGGGATCCTTGGCAGCTTCAGCGCAGCTTCAGCTTCGCAATCAGTACTCAGTACCGAAACCTCAACTAGTGGAACTAGTGGAGGATGGTCCCTGCGCAGGCAGTTCCTCAAGTGCACCGAGGGGACAACAGCAGTGATCTCTCCGTTAGGAGTTTAACGAGGCAATGCAGCAAATGCAGCAGTGTCGGCGGCGCTATAAAGCCGTCTCGTGGGAGCAGCAAG

Full Affymetrix probeset data:

Annotations for 1632662_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720