FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632663_at:

>probe:Drosophila_2:1632663_at:46:39; Interrogation_Position=437; Antisense; ATCTTTGAGCTCCTGCGCAAACAGG
>probe:Drosophila_2:1632663_at:282:563; Interrogation_Position=466; Antisense; GGAATTGAACCTCCAGGACCGAATA
>probe:Drosophila_2:1632663_at:322:405; Interrogation_Position=482; Antisense; GACCGAATAAGCGACCAGGATCTCA
>probe:Drosophila_2:1632663_at:182:39; Interrogation_Position=501; Antisense; ATCTCAAGCAGCAGGTGCGGCTCTA
>probe:Drosophila_2:1632663_at:364:569; Interrogation_Position=519; Antisense; GGCTCTATCGCTGAAGTGGCGCCGA
>probe:Drosophila_2:1632663_at:673:571; Interrogation_Position=549; Antisense; GGCTCACCCTACCTGAATGTACAGA
>probe:Drosophila_2:1632663_at:693:95; Interrogation_Position=610; Antisense; AGATTTGGTGTTGCCTCATACGGTC
>probe:Drosophila_2:1632663_at:129:271; Interrogation_Position=626; Antisense; CATACGGTCCACTAAGTGCGGGCAA
>probe:Drosophila_2:1632663_at:304:219; Interrogation_Position=639; Antisense; AAGTGCGGGCAAGTCTTTAGTCAGA
>probe:Drosophila_2:1632663_at:311:101; Interrogation_Position=661; Antisense; AGAGAGCTATCTCATCAGTCGATGA
>probe:Drosophila_2:1632663_at:70:61; Interrogation_Position=722; Antisense; ATGTATTCCACTTCGATCTATGTAT
>probe:Drosophila_2:1632663_at:161:483; Interrogation_Position=743; Antisense; GTATTTTGTGAGTTCCTGGTGTTAT
>probe:Drosophila_2:1632663_at:118:483; Interrogation_Position=787; Antisense; GTAGTAAATGGCTGTTCGGCTCTTA
>probe:Drosophila_2:1632663_at:24:473; Interrogation_Position=800; Antisense; GTTCGGCTCTTAGTCTCTTAAATCA

Paste this into a BLAST search page for me
ATCTTTGAGCTCCTGCGCAAACAGGGGAATTGAACCTCCAGGACCGAATAGACCGAATAAGCGACCAGGATCTCAATCTCAAGCAGCAGGTGCGGCTCTAGGCTCTATCGCTGAAGTGGCGCCGAGGCTCACCCTACCTGAATGTACAGAAGATTTGGTGTTGCCTCATACGGTCCATACGGTCCACTAAGTGCGGGCAAAAGTGCGGGCAAGTCTTTAGTCAGAAGAGAGCTATCTCATCAGTCGATGAATGTATTCCACTTCGATCTATGTATGTATTTTGTGAGTTCCTGGTGTTATGTAGTAAATGGCTGTTCGGCTCTTAGTTCGGCTCTTAGTCTCTTAAATCA

Full Affymetrix probeset data:

Annotations for 1632663_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720