Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632667_s_at:

>probe:Drosophila_2:1632667_s_at:51:595; Interrogation_Position=1046; Antisense; TGTGGAACACCAAGAACACTACCCA
>probe:Drosophila_2:1632667_s_at:422:531; Interrogation_Position=1115; Antisense; GGGTGAGACACTTCAGAAACGGCCT
>probe:Drosophila_2:1632667_s_at:156:141; Interrogation_Position=1133; Antisense; ACGGCCTGAAAATGGCATCACATAA
>probe:Drosophila_2:1632667_s_at:121:689; Interrogation_Position=1160; Antisense; TATATATATATTGCTCCCCGGTGGA
>probe:Drosophila_2:1632667_s_at:506:259; Interrogation_Position=744; Antisense; CACTCCCAACGTTTCCGTGGTCGAT
>probe:Drosophila_2:1632667_s_at:636:637; Interrogation_Position=764; Antisense; TCGATTTGACCGTGCGCTTGGGCAA
>probe:Drosophila_2:1632667_s_at:546:273; Interrogation_Position=780; Antisense; CTTGGGCAAGGGTGCGTCCTATGAT
>probe:Drosophila_2:1632667_s_at:4:81; Interrogation_Position=788; Antisense; AGGGTGCGTCCTATGATGAAATTAA
>probe:Drosophila_2:1632667_s_at:458:251; Interrogation_Position=816; Antisense; CAAGGTTCAGGAGGCCGCCAACGGA
>probe:Drosophila_2:1632667_s_at:197:443; Interrogation_Position=868; Antisense; GATGAGGAGGTCGTTTCTACCGATT
>probe:Drosophila_2:1632667_s_at:352:479; Interrogation_Position=880; Antisense; GTTTCTACCGATTTCCTCAGCGACA
>probe:Drosophila_2:1632667_s_at:566:391; Interrogation_Position=901; Antisense; GACACCCACTCGTCGGTGTTCGATG
>probe:Drosophila_2:1632667_s_at:117:397; Interrogation_Position=949; Antisense; GACAAGTTCGTGAAGCTGATCTCTT
>probe:Drosophila_2:1632667_s_at:576:377; Interrogation_Position=960; Antisense; GAAGCTGATCTCTTGGTACGACAAC

Paste this into a BLAST search page for me
TGTGGAACACCAAGAACACTACCCAGGGTGAGACACTTCAGAAACGGCCTACGGCCTGAAAATGGCATCACATAATATATATATATTGCTCCCCGGTGGACACTCCCAACGTTTCCGTGGTCGATTCGATTTGACCGTGCGCTTGGGCAACTTGGGCAAGGGTGCGTCCTATGATAGGGTGCGTCCTATGATGAAATTAACAAGGTTCAGGAGGCCGCCAACGGAGATGAGGAGGTCGTTTCTACCGATTGTTTCTACCGATTTCCTCAGCGACAGACACCCACTCGTCGGTGTTCGATGGACAAGTTCGTGAAGCTGATCTCTTGAAGCTGATCTCTTGGTACGACAAC

Full Affymetrix probeset data:

Annotations for 1632667_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime