Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632669_at:

>probe:Drosophila_2:1632669_at:197:297; Interrogation_Position=2451; Antisense; GCGACAGGAGTCTTTTGCCACGGGC
>probe:Drosophila_2:1632669_at:354:625; Interrogation_Position=2480; Antisense; TGCCCATTACGGTGCGTCACATTGA
>probe:Drosophila_2:1632669_at:354:85; Interrogation_Position=2506; Antisense; AGTGTCATCCGAATGTCCGAAGCGC
>probe:Drosophila_2:1632669_at:432:447; Interrogation_Position=2640; Antisense; GATGCGCAGCACATTCCAGAAGTAC
>probe:Drosophila_2:1632669_at:218:265; Interrogation_Position=2656; Antisense; CAGAAGTACCTGTCCTTCCAAAAGG
>probe:Drosophila_2:1632669_at:188:185; Interrogation_Position=2675; Antisense; AAAAGGACCATTCCGAGCTGCTGTT
>probe:Drosophila_2:1632669_at:500:119; Interrogation_Position=2690; Antisense; AGCTGCTGTTCTTTATTCTGCGACA
>probe:Drosophila_2:1632669_at:520:667; Interrogation_Position=2737; Antisense; TACATTCGCTGCAAGGACGGGCCTG
>probe:Drosophila_2:1632669_at:234:205; Interrogation_Position=2833; Antisense; AAGCCGTTCTACGAATCAGATCTGT
>probe:Drosophila_2:1632669_at:603:451; Interrogation_Position=2851; Antisense; GATCTGTTTCGCACAAATGGCTTCT
>probe:Drosophila_2:1632669_at:442:169; Interrogation_Position=2865; Antisense; AAATGGCTTCTCTTACGATCCCAAG
>probe:Drosophila_2:1632669_at:32:327; Interrogation_Position=2889; Antisense; GCGACGCATCATCCTTCAAATTGTG
>probe:Drosophila_2:1632669_at:599:535; Interrogation_Position=2913; Antisense; GGTCGACGGCAACACAGCTTAAGTT
>probe:Drosophila_2:1632669_at:677:711; Interrogation_Position=2937; Antisense; TTCAGCCATTTACTTCATCTCATTT

Paste this into a BLAST search page for me
GCGACAGGAGTCTTTTGCCACGGGCTGCCCATTACGGTGCGTCACATTGAAGTGTCATCCGAATGTCCGAAGCGCGATGCGCAGCACATTCCAGAAGTACCAGAAGTACCTGTCCTTCCAAAAGGAAAAGGACCATTCCGAGCTGCTGTTAGCTGCTGTTCTTTATTCTGCGACATACATTCGCTGCAAGGACGGGCCTGAAGCCGTTCTACGAATCAGATCTGTGATCTGTTTCGCACAAATGGCTTCTAAATGGCTTCTCTTACGATCCCAAGGCGACGCATCATCCTTCAAATTGTGGGTCGACGGCAACACAGCTTAAGTTTTCAGCCATTTACTTCATCTCATTT

Full Affymetrix probeset data:

Annotations for 1632669_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime