FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632670_at:

>probe:Drosophila_2:1632670_at:113:645; Interrogation_Position=2867; Antisense; TCTATGGCCACAAGGACTCCGGTAG
>probe:Drosophila_2:1632670_at:620:59; Interrogation_Position=2909; Antisense; ATGTTCCTCAACAGAATCCACAGCA
>probe:Drosophila_2:1632670_at:710:173; Interrogation_Position=2933; Antisense; AAACCTTCGACATGCAGGCGCTTAC
>probe:Drosophila_2:1632670_at:494:489; Interrogation_Position=2974; Antisense; GTGACTACGGGAGCGACCGGCATAC
>probe:Drosophila_2:1632670_at:143:531; Interrogation_Position=3010; Antisense; GGGTTGAGACCACCATCGCAAATAA
>probe:Drosophila_2:1632670_at:700:321; Interrogation_Position=3051; Antisense; GCGACCTTCCAGCATTGTTAGGCGC
>probe:Drosophila_2:1632670_at:388:71; Interrogation_Position=3070; Antisense; AGGCGCTGAGAGCTGATCACTTCCT
>probe:Drosophila_2:1632670_at:669:299; Interrogation_Position=3096; Antisense; CGCCGCCGATTGTATGCATATGTCA
>probe:Drosophila_2:1632670_at:371:379; Interrogation_Position=3132; Antisense; GAACCGACTTTCCATGTTATCAGTA
>probe:Drosophila_2:1632670_at:350:481; Interrogation_Position=3208; Antisense; GTTTGTCATCCCAGCATAGATGCTC
>probe:Drosophila_2:1632670_at:626:97; Interrogation_Position=3225; Antisense; AGATGCTCATCTTGCCTAGTGGTTT
>probe:Drosophila_2:1632670_at:533:519; Interrogation_Position=3243; Antisense; GTGGTTTCAAGGCACTAGCAACTAT
>probe:Drosophila_2:1632670_at:273:281; Interrogation_Position=3355; Antisense; CTCCCAGAACCGCTTACATTTATAT
>probe:Drosophila_2:1632670_at:48:257; Interrogation_Position=3398; Antisense; CACGAACTTTGCCTTACGAACCATA

Paste this into a BLAST search page for me
TCTATGGCCACAAGGACTCCGGTAGATGTTCCTCAACAGAATCCACAGCAAAACCTTCGACATGCAGGCGCTTACGTGACTACGGGAGCGACCGGCATACGGGTTGAGACCACCATCGCAAATAAGCGACCTTCCAGCATTGTTAGGCGCAGGCGCTGAGAGCTGATCACTTCCTCGCCGCCGATTGTATGCATATGTCAGAACCGACTTTCCATGTTATCAGTAGTTTGTCATCCCAGCATAGATGCTCAGATGCTCATCTTGCCTAGTGGTTTGTGGTTTCAAGGCACTAGCAACTATCTCCCAGAACCGCTTACATTTATATCACGAACTTTGCCTTACGAACCATA

Full Affymetrix probeset data:

Annotations for 1632670_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720