Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632672_at:

>probe:Drosophila_2:1632672_at:230:717; Interrogation_Position=3660; Antisense; TTCGTAGATGGTGGCCCAGACTTTT
>probe:Drosophila_2:1632672_at:716:103; Interrogation_Position=3677; Antisense; AGACTTTTGGACTGGCCACGACCAT
>probe:Drosophila_2:1632672_at:171:137; Interrogation_Position=3694; Antisense; ACGACCATAGAGCAGGCGGCCTTAT
>probe:Drosophila_2:1632672_at:247:333; Interrogation_Position=3709; Antisense; GCGGCCTTATTGATGCCTTTGCTAT
>probe:Drosophila_2:1632672_at:492:389; Interrogation_Position=3752; Antisense; GAAACATACCAGTGTCTTCGTAATT
>probe:Drosophila_2:1632672_at:55:687; Interrogation_Position=3850; Antisense; TATAATTTTCTTTCGCTTGTGATAT
>probe:Drosophila_2:1632672_at:449:603; Interrogation_Position=3887; Antisense; TGATTGCCCGAGTTTTAGACGTAAT
>probe:Drosophila_2:1632672_at:692:669; Interrogation_Position=3901; Antisense; TTAGACGTAATACATTCACCACTGT
>probe:Drosophila_2:1632672_at:294:501; Interrogation_Position=3953; Antisense; GTCGATATCAGTTTCGTGCGTGGAA
>probe:Drosophila_2:1632672_at:248:503; Interrogation_Position=3968; Antisense; GTGCGTGGAAACACACTCGTTTATC
>probe:Drosophila_2:1632672_at:646:281; Interrogation_Position=3983; Antisense; CTCGTTTATCAAATGGTTGCCAGTA
>probe:Drosophila_2:1632672_at:123:491; Interrogation_Position=4005; Antisense; GTAAATCGGCTATGACAGCTCCAAA
>probe:Drosophila_2:1632672_at:446:617; Interrogation_Position=4060; Antisense; TGCAGTTACCTTTTGCTTTGATTAA
>probe:Drosophila_2:1632672_at:461:419; Interrogation_Position=4106; Antisense; GAGTTTGCCTTAAGTTTGGCCTTGA

Paste this into a BLAST search page for me
TTCGTAGATGGTGGCCCAGACTTTTAGACTTTTGGACTGGCCACGACCATACGACCATAGAGCAGGCGGCCTTATGCGGCCTTATTGATGCCTTTGCTATGAAACATACCAGTGTCTTCGTAATTTATAATTTTCTTTCGCTTGTGATATTGATTGCCCGAGTTTTAGACGTAATTTAGACGTAATACATTCACCACTGTGTCGATATCAGTTTCGTGCGTGGAAGTGCGTGGAAACACACTCGTTTATCCTCGTTTATCAAATGGTTGCCAGTAGTAAATCGGCTATGACAGCTCCAAATGCAGTTACCTTTTGCTTTGATTAAGAGTTTGCCTTAAGTTTGGCCTTGA

Full Affymetrix probeset data:

Annotations for 1632672_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime