FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632673_at:

>probe:Drosophila_2:1632673_at:519:461; Interrogation_Position=104; Antisense; GATTCAAGCGGCGAGTGATCTATGT
>probe:Drosophila_2:1632673_at:344:513; Interrogation_Position=118; Antisense; GTGATCTATGTGGTACCAGCACCCA
>probe:Drosophila_2:1632673_at:62:487; Interrogation_Position=130; Antisense; GTACCAGCACCCACAACGAGTACAA
>probe:Drosophila_2:1632673_at:56:709; Interrogation_Position=14; Antisense; TTAACTGCTGGATCATTTAGAGAAT
>probe:Drosophila_2:1632673_at:230:253; Interrogation_Position=210; Antisense; CAACGCTCCTGAGGTGGTTTACCAG
>probe:Drosophila_2:1632673_at:164:517; Interrogation_Position=223; Antisense; GTGGTTTACCAGGTGGTCTACTGTT
>probe:Drosophila_2:1632673_at:569:79; Interrogation_Position=233; Antisense; AGGTGGTCTACTGTTCCTGGAAGAA
>probe:Drosophila_2:1632673_at:29:375; Interrogation_Position=252; Antisense; GAAGAACAACTGGTGTCGTCCCGTC
>probe:Drosophila_2:1632673_at:506:503; Interrogation_Position=269; Antisense; GTCCCGTCTCGAACACCGTGAGAAA
>probe:Drosophila_2:1632673_at:276:525; Interrogation_Position=303; Antisense; GGGCTTCTGCAAGTTCAATGGATAA
>probe:Drosophila_2:1632673_at:184:651; Interrogation_Position=40; Antisense; TCAACGATGAAGTACTTTGTGATCT
>probe:Drosophila_2:1632673_at:605:277; Interrogation_Position=54; Antisense; CTTTGTGATCTGTGTTTTGGCTGCA
>probe:Drosophila_2:1632673_at:624:691; Interrogation_Position=69; Antisense; TTTGGCTGCAATCGTTCTTTTCCAG
>probe:Drosophila_2:1632673_at:636:693; Interrogation_Position=87; Antisense; TTTCCAGTCCGCATCGGGATTCAAG

Paste this into a BLAST search page for me
GATTCAAGCGGCGAGTGATCTATGTGTGATCTATGTGGTACCAGCACCCAGTACCAGCACCCACAACGAGTACAATTAACTGCTGGATCATTTAGAGAATCAACGCTCCTGAGGTGGTTTACCAGGTGGTTTACCAGGTGGTCTACTGTTAGGTGGTCTACTGTTCCTGGAAGAAGAAGAACAACTGGTGTCGTCCCGTCGTCCCGTCTCGAACACCGTGAGAAAGGGCTTCTGCAAGTTCAATGGATAATCAACGATGAAGTACTTTGTGATCTCTTTGTGATCTGTGTTTTGGCTGCATTTGGCTGCAATCGTTCTTTTCCAGTTTCCAGTCCGCATCGGGATTCAAG

Full Affymetrix probeset data:

Annotations for 1632673_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720