FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632678_at:

>probe:Drosophila_2:1632678_at:681:317; Interrogation_Position=1473; Antisense; GCCGGTGATCTATGTGGGCCATCCA
>probe:Drosophila_2:1632678_at:220:49; Interrogation_Position=1493; Antisense; ATCCATGGGATGTCACTCGAACTGT
>probe:Drosophila_2:1632678_at:154:637; Interrogation_Position=1509; Antisense; TCGAACTGTGGAGGTATCCGCCTTT
>probe:Drosophila_2:1632678_at:24:47; Interrogation_Position=1524; Antisense; ATCCGCCTTTGTGCCGAGATATAGC
>probe:Drosophila_2:1632678_at:192:335; Interrogation_Position=1581; Antisense; GCTGCTCCTCAAGTATAACGTGGTC
>probe:Drosophila_2:1632678_at:491:9; Interrogation_Position=1636; Antisense; ATTCCCTGCTTTGGTTTCGATGGCG
>probe:Drosophila_2:1632678_at:8:457; Interrogation_Position=1680; Antisense; GATACACAGCTTCTTGGTGGGCAGA
>probe:Drosophila_2:1632678_at:196:603; Interrogation_Position=1739; Antisense; TGATAATCACCAGCGTGGGTTCCCT
>probe:Drosophila_2:1632678_at:165:521; Interrogation_Position=1789; Antisense; GTGGCCTGGTTGAGTTTTCTGCGAC
>probe:Drosophila_2:1632678_at:644:613; Interrogation_Position=1808; Antisense; TGCGACCCCTGCTTTAAGAACTGAA
>probe:Drosophila_2:1632678_at:401:711; Interrogation_Position=1860; Antisense; TTCAACTCCCTGCAAAGACGCTAGA
>probe:Drosophila_2:1632678_at:96:677; Interrogation_Position=1881; Antisense; TAGACTGCTATTTCACCTTCACGAA
>probe:Drosophila_2:1632678_at:68:457; Interrogation_Position=1946; Antisense; GATAGCTTTTTGTCATAGTCCTTAG
>probe:Drosophila_2:1632678_at:252:13; Interrogation_Position=1986; Antisense; ATTTTCGTACGGTTGTCGAGCTCAA

Paste this into a BLAST search page for me
GCCGGTGATCTATGTGGGCCATCCAATCCATGGGATGTCACTCGAACTGTTCGAACTGTGGAGGTATCCGCCTTTATCCGCCTTTGTGCCGAGATATAGCGCTGCTCCTCAAGTATAACGTGGTCATTCCCTGCTTTGGTTTCGATGGCGGATACACAGCTTCTTGGTGGGCAGATGATAATCACCAGCGTGGGTTCCCTGTGGCCTGGTTGAGTTTTCTGCGACTGCGACCCCTGCTTTAAGAACTGAATTCAACTCCCTGCAAAGACGCTAGATAGACTGCTATTTCACCTTCACGAAGATAGCTTTTTGTCATAGTCCTTAGATTTTCGTACGGTTGTCGAGCTCAA

Full Affymetrix probeset data:

Annotations for 1632678_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720