Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632680_at:

>probe:Drosophila_2:1632680_at:228:519; Interrogation_Position=1663; Antisense; GTGGCTCCCAAGGTGAAGGGTTTCT
>probe:Drosophila_2:1632680_at:26:377; Interrogation_Position=1689; Antisense; GAAGAAGGGCAGCTCCCTGCAATTG
>probe:Drosophila_2:1632680_at:620:165; Interrogation_Position=1709; Antisense; AATTGCAAACCTGCCGAAGGACACC
>probe:Drosophila_2:1632680_at:559:371; Interrogation_Position=1724; Antisense; GAAGGACACCCAATCAACTGTGGTA
>probe:Drosophila_2:1632680_at:572:397; Interrogation_Position=1777; Antisense; GACAAGTTGCTGTGCCTGGAGGCAT
>probe:Drosophila_2:1632680_at:149:447; Interrogation_Position=1807; Antisense; GATGCGCAGGTCACGGTCAACAAGT
>probe:Drosophila_2:1632680_at:625:219; Interrogation_Position=1828; Antisense; AAGTGCCACGAGATGCTCGGCGATC
>probe:Drosophila_2:1632680_at:411:641; Interrogation_Position=1844; Antisense; TCGGCGATCAGCAGTGGCGGCACAC
>probe:Drosophila_2:1632680_at:480:503; Interrogation_Position=1883; Antisense; GTCCCGTCTACAACATGGCCAAAGG
>probe:Drosophila_2:1632680_at:686:35; Interrogation_Position=1948; Antisense; ATCAGTCTGGATCTGTGCTCCAAGT
>probe:Drosophila_2:1632680_at:210:331; Interrogation_Position=1985; Antisense; GCGGCTCCTGGGACATTGTGCAGCT
>probe:Drosophila_2:1632680_at:254:161; Interrogation_Position=2060; Antisense; ACAAGGCGCTGTGAGCGATTCGCTC
>probe:Drosophila_2:1632680_at:468:417; Interrogation_Position=2072; Antisense; GAGCGATTCGCTCGGATCGAATAAT
>probe:Drosophila_2:1632680_at:235:241; Interrogation_Position=2150; Antisense; AATAGCCAGTATTTTTTCATCAAAC

Paste this into a BLAST search page for me
GTGGCTCCCAAGGTGAAGGGTTTCTGAAGAAGGGCAGCTCCCTGCAATTGAATTGCAAACCTGCCGAAGGACACCGAAGGACACCCAATCAACTGTGGTAGACAAGTTGCTGTGCCTGGAGGCATGATGCGCAGGTCACGGTCAACAAGTAAGTGCCACGAGATGCTCGGCGATCTCGGCGATCAGCAGTGGCGGCACACGTCCCGTCTACAACATGGCCAAAGGATCAGTCTGGATCTGTGCTCCAAGTGCGGCTCCTGGGACATTGTGCAGCTACAAGGCGCTGTGAGCGATTCGCTCGAGCGATTCGCTCGGATCGAATAATAATAGCCAGTATTTTTTCATCAAAC

Full Affymetrix probeset data:

Annotations for 1632680_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime