Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632681_at:

>probe:Drosophila_2:1632681_at:504:57; Interrogation_Position=2880; Antisense; ATGTAAAGCAAAGGCCGCCGTCAAC
>probe:Drosophila_2:1632681_at:250:159; Interrogation_Position=2919; Antisense; ACACACACTTAAATGTTCAATGTTA
>probe:Drosophila_2:1632681_at:699:471; Interrogation_Position=2933; Antisense; GTTCAATGTTAATGCCTAAGTCTTA
>probe:Drosophila_2:1632681_at:99:311; Interrogation_Position=2946; Antisense; GCCTAAGTCTTAAAACTATACACAC
>probe:Drosophila_2:1632681_at:12:135; Interrogation_Position=2967; Antisense; ACACATAAACATTTGAAAGCCGTAC
>probe:Drosophila_2:1632681_at:448:391; Interrogation_Position=2981; Antisense; GAAAGCCGTACATAGACTTAAAGGT
>probe:Drosophila_2:1632681_at:618:215; Interrogation_Position=3139; Antisense; AAGTAATACCCTAAGTTGTGTGTAT
>probe:Drosophila_2:1632681_at:727:129; Interrogation_Position=3146; Antisense; ACCCTAAGTTGTGTGTATAAAGCCA
>probe:Drosophila_2:1632681_at:113:685; Interrogation_Position=3161; Antisense; TATAAAGCCAGATTAGTCCTAACCT
>probe:Drosophila_2:1632681_at:589:677; Interrogation_Position=3174; Antisense; TAGTCCTAACCTAATTTATGTATGT
>probe:Drosophila_2:1632681_at:557:481; Interrogation_Position=3244; Antisense; GTATTATGTGCTAAGTGTAAACGAT
>probe:Drosophila_2:1632681_at:80:59; Interrogation_Position=3271; Antisense; ATGTATTGTAATTTGGCCATATTGA
>probe:Drosophila_2:1632681_at:26:243; Interrogation_Position=3280; Antisense; AATTTGGCCATATTGATAGTTGAAT
>probe:Drosophila_2:1632681_at:615:583; Interrogation_Position=3377; Antisense; TGGCAATCACCAGAAAAATACACAA

Paste this into a BLAST search page for me
ATGTAAAGCAAAGGCCGCCGTCAACACACACACTTAAATGTTCAATGTTAGTTCAATGTTAATGCCTAAGTCTTAGCCTAAGTCTTAAAACTATACACACACACATAAACATTTGAAAGCCGTACGAAAGCCGTACATAGACTTAAAGGTAAGTAATACCCTAAGTTGTGTGTATACCCTAAGTTGTGTGTATAAAGCCATATAAAGCCAGATTAGTCCTAACCTTAGTCCTAACCTAATTTATGTATGTGTATTATGTGCTAAGTGTAAACGATATGTATTGTAATTTGGCCATATTGAAATTTGGCCATATTGATAGTTGAATTGGCAATCACCAGAAAAATACACAA

Full Affymetrix probeset data:

Annotations for 1632681_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime