Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632684_s_at:

>probe:Drosophila_2:1632684_s_at:165:303; Interrogation_Position=104; Antisense; CCGCATACTACGAGAGGCGTCGCAA
>probe:Drosophila_2:1632684_s_at:282:271; Interrogation_Position=107; Antisense; CATACTACGAGAGGCGTCGCAAGAA
>probe:Drosophila_2:1632684_s_at:39:101; Interrogation_Position=116; Antisense; AGAGGCGTCGCAAGAACAATGCTGC
>probe:Drosophila_2:1632684_s_at:442:501; Interrogation_Position=122; Antisense; GTCGCAAGAACAATGCTGCCGCCAA
>probe:Drosophila_2:1632684_s_at:5:211; Interrogation_Position=127; Antisense; AAGAACAATGCTGCCGCCAAGAAGT
>probe:Drosophila_2:1632684_s_at:598:51; Interrogation_Position=134; Antisense; ATGCTGCCGCCAAGAAGTCCCGCGA
>probe:Drosophila_2:1632684_s_at:3:211; Interrogation_Position=145; Antisense; AAGAAGTCCCGCGATCGCCGCCGCA
>probe:Drosophila_2:1632684_s_at:396:57; Interrogation_Position=179; Antisense; ATGAGATCGCCATCAGGGCCGCCTA
>probe:Drosophila_2:1632684_s_at:336:81; Interrogation_Position=193; Antisense; AGGGCCGCCTATCTGGAACGCCAGA
>probe:Drosophila_2:1632684_s_at:372:585; Interrogation_Position=206; Antisense; TGGAACGCCAGAACATCGAGCTCTT
>probe:Drosophila_2:1632684_s_at:487:381; Interrogation_Position=208; Antisense; GAACGCCAGAACATCGAGCTCTTGT
>probe:Drosophila_2:1632684_s_at:572:133; Interrogation_Position=210; Antisense; ACGCCAGAACATCGAGCTCTTGTGC
>probe:Drosophila_2:1632684_s_at:677:251; Interrogation_Position=65; Antisense; CAAACTCGGGCATCAGCTCGGGCAG
>probe:Drosophila_2:1632684_s_at:618:193; Interrogation_Position=67; Antisense; AACTCGGGCATCAGCTCGGGCAGCC

Paste this into a BLAST search page for me
CCGCATACTACGAGAGGCGTCGCAACATACTACGAGAGGCGTCGCAAGAAAGAGGCGTCGCAAGAACAATGCTGCGTCGCAAGAACAATGCTGCCGCCAAAAGAACAATGCTGCCGCCAAGAAGTATGCTGCCGCCAAGAAGTCCCGCGAAAGAAGTCCCGCGATCGCCGCCGCAATGAGATCGCCATCAGGGCCGCCTAAGGGCCGCCTATCTGGAACGCCAGATGGAACGCCAGAACATCGAGCTCTTGAACGCCAGAACATCGAGCTCTTGTACGCCAGAACATCGAGCTCTTGTGCCAAACTCGGGCATCAGCTCGGGCAGAACTCGGGCATCAGCTCGGGCAGCC

Full Affymetrix probeset data:

Annotations for 1632684_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime