FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632685_at:

>probe:Drosophila_2:1632685_at:711:631; Interrogation_Position=1009; Antisense; TCCGGCTGTGTCCAGCTACTCGGCT
>probe:Drosophila_2:1632685_at:660:263; Interrogation_Position=1021; Antisense; CAGCTACTCGGCTCCCGCTGTGGTC
>probe:Drosophila_2:1632685_at:398:333; Interrogation_Position=1037; Antisense; GCTGTGGTCAGCAGCTACTCCGGAT
>probe:Drosophila_2:1632685_at:192:593; Interrogation_Position=1039; Antisense; TGTGGTCAGCAGCTACTCCGGATCC
>probe:Drosophila_2:1632685_at:349:591; Interrogation_Position=1041; Antisense; TGGTCAGCAGCTACTCCGGATCCTC
>probe:Drosophila_2:1632685_at:18:545; Interrogation_Position=1058; Antisense; GGATCCTCCGGCACCGTGTACGGCT
>probe:Drosophila_2:1632685_at:710:303; Interrogation_Position=1065; Antisense; CCGGCACCGTGTACGGCTCCAACGG
>probe:Drosophila_2:1632685_at:310:337; Interrogation_Position=1080; Antisense; GCTCCAACGGCGGATACGTCTACTA
>probe:Drosophila_2:1632685_at:253:1; Interrogation_Position=1081; Antisense; CTCCAACGGCGGATACGTCTACTAA
>probe:Drosophila_2:1632685_at:333:625; Interrogation_Position=538; Antisense; TGCCGTGTCCGGATACTCTCAGACC
>probe:Drosophila_2:1632685_at:370:515; Interrogation_Position=542; Antisense; GTGTCCGGATACTCTCAGACCTACA
>probe:Drosophila_2:1632685_at:136:599; Interrogation_Position=543; Antisense; TGTCCGGATACTCTCAGACCTACAC
>probe:Drosophila_2:1632685_at:394:533; Interrogation_Position=988; Antisense; GGTGACCAAGACCTATTCCGCTCCG
>probe:Drosophila_2:1632685_at:599:103; Interrogation_Position=996; Antisense; AGACCTATTCCGCTCCGGCTGTGTC

Paste this into a BLAST search page for me
TCCGGCTGTGTCCAGCTACTCGGCTCAGCTACTCGGCTCCCGCTGTGGTCGCTGTGGTCAGCAGCTACTCCGGATTGTGGTCAGCAGCTACTCCGGATCCTGGTCAGCAGCTACTCCGGATCCTCGGATCCTCCGGCACCGTGTACGGCTCCGGCACCGTGTACGGCTCCAACGGGCTCCAACGGCGGATACGTCTACTACTCCAACGGCGGATACGTCTACTAATGCCGTGTCCGGATACTCTCAGACCGTGTCCGGATACTCTCAGACCTACATGTCCGGATACTCTCAGACCTACACGGTGACCAAGACCTATTCCGCTCCGAGACCTATTCCGCTCCGGCTGTGTC

Full Affymetrix probeset data:

Annotations for 1632685_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720