FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632689_at:

>probe:Drosophila_2:1632689_at:574:191; Interrogation_Position=400; Antisense; AACTTTAAGATGGTCCTGGTGGTGC
>probe:Drosophila_2:1632689_at:211:137; Interrogation_Position=519; Antisense; ACTACTGCGGTCGTGGGAGAACTGC
>probe:Drosophila_2:1632689_at:80:553; Interrogation_Position=534; Antisense; GGAGAACTGCGGTTGCGCCAAGATA
>probe:Drosophila_2:1632689_at:45:253; Interrogation_Position=552; Antisense; CAAGATAGCCGTTCGCGTGGAGAGC
>probe:Drosophila_2:1632689_at:680:111; Interrogation_Position=617; Antisense; AGCAACTGAACACGTGTCTCATCCG
>probe:Drosophila_2:1632689_at:175:411; Interrogation_Position=643; Antisense; GACGCCGGTCGCACACAAATAGAGG
>probe:Drosophila_2:1632689_at:653:99; Interrogation_Position=663; Antisense; AGAGGCCAACTCCAAGACTGTGCTG
>probe:Drosophila_2:1632689_at:275:253; Interrogation_Position=675; Antisense; CAAGACTGTGCTGGCCGTGGGTCCA
>probe:Drosophila_2:1632689_at:114:131; Interrogation_Position=727; Antisense; ACCGGCCACCTGAAATTGCTGTAAG
>probe:Drosophila_2:1632689_at:439:5; Interrogation_Position=741; Antisense; ATTGCTGTAAGATCCGCACTTCGGA
>probe:Drosophila_2:1632689_at:300:561; Interrogation_Position=763; Antisense; GGAAACTCTCACAGGCCATTGGCAT
>probe:Drosophila_2:1632689_at:135:651; Interrogation_Position=818; Antisense; TCACAAAGCAATACGGCGCACCGGT
>probe:Drosophila_2:1632689_at:637:437; Interrogation_Position=874; Antisense; GAGGACGACTGTGACATGCAAGCTA
>probe:Drosophila_2:1632689_at:470:177; Interrogation_Position=949; Antisense; AAACGATTGACAGTCCGGCCTGGAA

Paste this into a BLAST search page for me
AACTTTAAGATGGTCCTGGTGGTGCACTACTGCGGTCGTGGGAGAACTGCGGAGAACTGCGGTTGCGCCAAGATACAAGATAGCCGTTCGCGTGGAGAGCAGCAACTGAACACGTGTCTCATCCGGACGCCGGTCGCACACAAATAGAGGAGAGGCCAACTCCAAGACTGTGCTGCAAGACTGTGCTGGCCGTGGGTCCAACCGGCCACCTGAAATTGCTGTAAGATTGCTGTAAGATCCGCACTTCGGAGGAAACTCTCACAGGCCATTGGCATTCACAAAGCAATACGGCGCACCGGTGAGGACGACTGTGACATGCAAGCTAAAACGATTGACAGTCCGGCCTGGAA

Full Affymetrix probeset data:

Annotations for 1632689_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720