Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632690_a_at:

>probe:Drosophila_2:1632690_a_at:526:619; Interrogation_Position=261; Antisense; TGCTCCTGTGGCTACCGCCGGAGTG
>probe:Drosophila_2:1632690_a_at:407:337; Interrogation_Position=289; Antisense; GCTCCATATGCCTCCAGCTTCAATG
>probe:Drosophila_2:1632690_a_at:563:291; Interrogation_Position=333; Antisense; CGTGGCATACCCAGTGGCTCCTGCT
>probe:Drosophila_2:1632690_a_at:198:319; Interrogation_Position=574; Antisense; GCCGCACCAGCCAAGTTCGGATTCG
>probe:Drosophila_2:1632690_a_at:13:473; Interrogation_Position=588; Antisense; GTTCGGATTCGGACCCTTCGCCGCT
>probe:Drosophila_2:1632690_a_at:476:319; Interrogation_Position=667; Antisense; GCCCCATACTTCTTCTAAGGACTTA
>probe:Drosophila_2:1632690_a_at:493:223; Interrogation_Position=683; Antisense; AAGGACTTAGCTGTAGGATCACCCA
>probe:Drosophila_2:1632690_a_at:492:599; Interrogation_Position=694; Antisense; TGTAGGATCACCCAGCTCATACACT
>probe:Drosophila_2:1632690_a_at:279:281; Interrogation_Position=717; Antisense; CTCCCATCCGTCCTATTAGATTGTA
>probe:Drosophila_2:1632690_a_at:490:705; Interrogation_Position=732; Antisense; TTAGATTGTAGAAACTAGCCCAAAT
>probe:Drosophila_2:1632690_a_at:521:675; Interrogation_Position=747; Antisense; TAGCCCAAATCTTCATCTCCTAGAG
>probe:Drosophila_2:1632690_a_at:539:35; Interrogation_Position=755; Antisense; ATCTTCATCTCCTAGAGAGCAGCAA
>probe:Drosophila_2:1632690_a_at:295:421; Interrogation_Position=771; Antisense; GAGCAGCAATGCTTGGCGAATAAAC
>probe:Drosophila_2:1632690_a_at:284:343; Interrogation_Position=781; Antisense; GCTTGGCGAATAAACAATTATCCAT

Paste this into a BLAST search page for me
TGCTCCTGTGGCTACCGCCGGAGTGGCTCCATATGCCTCCAGCTTCAATGCGTGGCATACCCAGTGGCTCCTGCTGCCGCACCAGCCAAGTTCGGATTCGGTTCGGATTCGGACCCTTCGCCGCTGCCCCATACTTCTTCTAAGGACTTAAAGGACTTAGCTGTAGGATCACCCATGTAGGATCACCCAGCTCATACACTCTCCCATCCGTCCTATTAGATTGTATTAGATTGTAGAAACTAGCCCAAATTAGCCCAAATCTTCATCTCCTAGAGATCTTCATCTCCTAGAGAGCAGCAAGAGCAGCAATGCTTGGCGAATAAACGCTTGGCGAATAAACAATTATCCAT

Full Affymetrix probeset data:

Annotations for 1632690_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime