FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632691_at:

>probe:Drosophila_2:1632691_at:79:645; Interrogation_Position=2150; Antisense; TCATTTCCGCTTCCTGGTAAAAAGA
>probe:Drosophila_2:1632691_at:264:187; Interrogation_Position=2186; Antisense; AAGTGCAGAGAGAGCCACAAATTCT
>probe:Drosophila_2:1632691_at:57:663; Interrogation_Position=2248; Antisense; TAAACTGTCGTGTCAATCCCAAAAT
>probe:Drosophila_2:1632691_at:241:273; Interrogation_Position=2320; Antisense; CATTGCATAAACTTCGCGTACGAGT
>probe:Drosophila_2:1632691_at:637:425; Interrogation_Position=2341; Antisense; GAGTAGTAACCAATATGCCCTTAAA
>probe:Drosophila_2:1632691_at:161:219; Interrogation_Position=2369; Antisense; AAGTCTAAACACAGCCAACAACCAA
>probe:Drosophila_2:1632691_at:429:191; Interrogation_Position=2415; Antisense; AACCTAAGCCCAAGCGTATATATTA
>probe:Drosophila_2:1632691_at:442:717; Interrogation_Position=2556; Antisense; TTCGAACTTGTTTCCCTACTGGTCG
>probe:Drosophila_2:1632691_at:340:599; Interrogation_Position=2564; Antisense; TGTTTCCCTACTGGTCGCGTTTTTG
>probe:Drosophila_2:1632691_at:85:327; Interrogation_Position=2580; Antisense; GCGTTTTTGGGACCCCACACAGAGC
>probe:Drosophila_2:1632691_at:451:103; Interrogation_Position=2600; Antisense; AGAGCCTCTGATCTCAGAATCCTGG
>probe:Drosophila_2:1632691_at:473:235; Interrogation_Position=2617; Antisense; AATCCTGGCAGTCCCGAATTCGCGA
>probe:Drosophila_2:1632691_at:53:363; Interrogation_Position=2632; Antisense; GAATTCGCGACGCAGTAGGTCGACA
>probe:Drosophila_2:1632691_at:662:535; Interrogation_Position=2649; Antisense; GGTCGACATGATCGAGCATCTTTTA

Paste this into a BLAST search page for me
TCATTTCCGCTTCCTGGTAAAAAGAAAGTGCAGAGAGAGCCACAAATTCTTAAACTGTCGTGTCAATCCCAAAATCATTGCATAAACTTCGCGTACGAGTGAGTAGTAACCAATATGCCCTTAAAAAGTCTAAACACAGCCAACAACCAAAACCTAAGCCCAAGCGTATATATTATTCGAACTTGTTTCCCTACTGGTCGTGTTTCCCTACTGGTCGCGTTTTTGGCGTTTTTGGGACCCCACACAGAGCAGAGCCTCTGATCTCAGAATCCTGGAATCCTGGCAGTCCCGAATTCGCGAGAATTCGCGACGCAGTAGGTCGACAGGTCGACATGATCGAGCATCTTTTA

Full Affymetrix probeset data:

Annotations for 1632691_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720