FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632693_at:

>probe:Drosophila_2:1632693_at:391:615; Interrogation_Position=101; Antisense; TGAAGTGCACAGTTGCCATCGTCTT
>probe:Drosophila_2:1632693_at:609:97; Interrogation_Position=179; Antisense; AGATCCTGCGTCTGGAGTCCGACGT
>probe:Drosophila_2:1632693_at:256:83; Interrogation_Position=212; Antisense; AGGGCTACAACTTTGCTTTGGAGAC
>probe:Drosophila_2:1632693_at:672:691; Interrogation_Position=223; Antisense; TTTGCTTTGGAGACCAGCGACGGCA
>probe:Drosophila_2:1632693_at:129:659; Interrogation_Position=26; Antisense; TAACGTTGACTAGCCGTTCGGTCGC
>probe:Drosophila_2:1632693_at:498:81; Interrogation_Position=263; Antisense; AGGGTCAGCTCAAGAACGTCGGCAC
>probe:Drosophila_2:1632693_at:607:139; Interrogation_Position=278; Antisense; ACGTCGGCACCGAACAGGAGGCCAT
>probe:Drosophila_2:1632693_at:3:71; Interrogation_Position=296; Antisense; AGGCCATCGTGGTCCGCGGATCCTA
>probe:Drosophila_2:1632693_at:93:47; Interrogation_Position=315; Antisense; ATCCTACTCCTTCGTGGCCGATGAT
>probe:Drosophila_2:1632693_at:608:157; Interrogation_Position=350; Antisense; ACACGGTCAACTACATCGCTGACGA
>probe:Drosophila_2:1632693_at:25:473; Interrogation_Position=41; Antisense; GTTCGGTCGCAAGTTCCCATCGAAT
>probe:Drosophila_2:1632693_at:529:507; Interrogation_Position=412; Antisense; GTGCCCATCGGCAACTAAGCGGATA
>probe:Drosophila_2:1632693_at:314:669; Interrogation_Position=441; Antisense; TACGCTAACCGAGAGCTGTTCTATG
>probe:Drosophila_2:1632693_at:674:633; Interrogation_Position=55; Antisense; TCCCATCGAATCCTTAGCCAAATTA

Paste this into a BLAST search page for me
TGAAGTGCACAGTTGCCATCGTCTTAGATCCTGCGTCTGGAGTCCGACGTAGGGCTACAACTTTGCTTTGGAGACTTTGCTTTGGAGACCAGCGACGGCATAACGTTGACTAGCCGTTCGGTCGCAGGGTCAGCTCAAGAACGTCGGCACACGTCGGCACCGAACAGGAGGCCATAGGCCATCGTGGTCCGCGGATCCTAATCCTACTCCTTCGTGGCCGATGATACACGGTCAACTACATCGCTGACGAGTTCGGTCGCAAGTTCCCATCGAATGTGCCCATCGGCAACTAAGCGGATATACGCTAACCGAGAGCTGTTCTATGTCCCATCGAATCCTTAGCCAAATTA

Full Affymetrix probeset data:

Annotations for 1632693_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720