Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632694_at:

>probe:Drosophila_2:1632694_at:605:517; Interrogation_Position=1686; Antisense; GTGTGTAAGCGCATGGACCCAAGAT
>probe:Drosophila_2:1632694_at:477:243; Interrogation_Position=1711; Antisense; AATTTGCTTAGCCAACGCGACCAGT
>probe:Drosophila_2:1632694_at:464:619; Interrogation_Position=1745; Antisense; TGCTCCATTTGGTCCACGAAGCCTA
>probe:Drosophila_2:1632694_at:547:101; Interrogation_Position=1763; Antisense; AAGCCTACTTCGCAGAAGGTTCCAA
>probe:Drosophila_2:1632694_at:326:711; Interrogation_Position=1810; Antisense; TTCACCACCATGTCTCTGAGGGAAT
>probe:Drosophila_2:1632694_at:257:433; Interrogation_Position=1827; Antisense; GAGGGAATTGTTCTTCTTCAGATTT
>probe:Drosophila_2:1632694_at:403:649; Interrogation_Position=1844; Antisense; TCAGATTTGGCCAGAGTTCCTTCGG
>probe:Drosophila_2:1632694_at:91:257; Interrogation_Position=1870; Antisense; CAAACCCTGTATTTCGGCAGCGATT
>probe:Drosophila_2:1632694_at:573:119; Interrogation_Position=1888; Antisense; AGCGATTTCGTCGAGGGCGGTTCAC
>probe:Drosophila_2:1632694_at:200:541; Interrogation_Position=1906; Antisense; GGTTCACCCATAAATTCCCTGACAA
>probe:Drosophila_2:1632694_at:590:159; Interrogation_Position=1927; Antisense; ACAAGGCTGCCTGTTTTTGTCCGGA
>probe:Drosophila_2:1632694_at:542:675; Interrogation_Position=1942; Antisense; TTTGTCCGGACCTTCAACTGCTTGG
>probe:Drosophila_2:1632694_at:292:231; Interrogation_Position=2154; Antisense; AATGTTCAATTGTTGCCGAGACAGC
>probe:Drosophila_2:1632694_at:155:369; Interrogation_Position=2239; Antisense; GAATGAACGCTTTCCTTTGTGGTTA

Paste this into a BLAST search page for me
GTGTGTAAGCGCATGGACCCAAGATAATTTGCTTAGCCAACGCGACCAGTTGCTCCATTTGGTCCACGAAGCCTAAAGCCTACTTCGCAGAAGGTTCCAATTCACCACCATGTCTCTGAGGGAATGAGGGAATTGTTCTTCTTCAGATTTTCAGATTTGGCCAGAGTTCCTTCGGCAAACCCTGTATTTCGGCAGCGATTAGCGATTTCGTCGAGGGCGGTTCACGGTTCACCCATAAATTCCCTGACAAACAAGGCTGCCTGTTTTTGTCCGGATTTGTCCGGACCTTCAACTGCTTGGAATGTTCAATTGTTGCCGAGACAGCGAATGAACGCTTTCCTTTGTGGTTA

Full Affymetrix probeset data:

Annotations for 1632694_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime