FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632695_at:

>probe:Drosophila_2:1632695_at:59:459; Interrogation_Position=1008; Antisense; GATATCCTGACTATTGGCAAAGCTT
>probe:Drosophila_2:1632695_at:448:173; Interrogation_Position=1026; Antisense; AAAGCTTTTGCCGATGCCATTGAAG
>probe:Drosophila_2:1632695_at:636:313; Interrogation_Position=1041; Antisense; GCCATTGAAGCACTGCCGTACGGAA
>probe:Drosophila_2:1632695_at:351:559; Interrogation_Position=1062; Antisense; GGAACCGTCTACCAGTATGGCTCTA
>probe:Drosophila_2:1632695_at:425:697; Interrogation_Position=1099; Antisense; TTTATGTGGCCACTGGAACCTCCGT
>probe:Drosophila_2:1632695_at:384:379; Interrogation_Position=1114; Antisense; GAACCTCCGTGGACTGGGTGTTCAA
>probe:Drosophila_2:1632695_at:127:29; Interrogation_Position=1180; Antisense; ATAAGGGTCGCTACGGCTTTATCCT
>probe:Drosophila_2:1632695_at:645:453; Interrogation_Position=1217; Antisense; GATCATTCCCAACTGCGAGGAGCTA
>probe:Drosophila_2:1632695_at:348:421; Interrogation_Position=1296; Antisense; GAGCACGATTTATTTATCCCGAATT
>probe:Drosophila_2:1632695_at:246:403; Interrogation_Position=789; Antisense; GACTCCTATTGGCTCCAGAACAATG
>probe:Drosophila_2:1632695_at:77:613; Interrogation_Position=821; Antisense; TGACAATCCCTGCAGTGAGACTTTT
>probe:Drosophila_2:1632695_at:506:489; Interrogation_Position=926; Antisense; GTACATATCCTTCCACTCATATGGA
>probe:Drosophila_2:1632695_at:246:67; Interrogation_Position=946; Antisense; ATGGACAGTATTTGCTTTCGCCCTA
>probe:Drosophila_2:1632695_at:470:717; Interrogation_Position=962; Antisense; TTCGCCCTACGGTCATACCAATGAG

Paste this into a BLAST search page for me
GATATCCTGACTATTGGCAAAGCTTAAAGCTTTTGCCGATGCCATTGAAGGCCATTGAAGCACTGCCGTACGGAAGGAACCGTCTACCAGTATGGCTCTATTTATGTGGCCACTGGAACCTCCGTGAACCTCCGTGGACTGGGTGTTCAAATAAGGGTCGCTACGGCTTTATCCTGATCATTCCCAACTGCGAGGAGCTAGAGCACGATTTATTTATCCCGAATTGACTCCTATTGGCTCCAGAACAATGTGACAATCCCTGCAGTGAGACTTTTGTACATATCCTTCCACTCATATGGAATGGACAGTATTTGCTTTCGCCCTATTCGCCCTACGGTCATACCAATGAG

Full Affymetrix probeset data:

Annotations for 1632695_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720