FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632696_at:

>probe:Drosophila_2:1632696_at:234:223; Interrogation_Position=115; Antisense; AAGGGTTCGCAGTCTTCAGAGTCCG
>probe:Drosophila_2:1632696_at:713:717; Interrogation_Position=120; Antisense; TTCGCAGTCTTCAGAGTCCGAGGAA
>probe:Drosophila_2:1632696_at:443:29; Interrogation_Position=147; Antisense; ATACTTTAAGAATGTGTCCGAGCGC
>probe:Drosophila_2:1632696_at:589:369; Interrogation_Position=156; Antisense; GAATGTGTCCGAGCGCTTCGATAAG
>probe:Drosophila_2:1632696_at:559:303; Interrogation_Position=164; Antisense; CCGAGCGCTTCGATAAGGACATAAA
>probe:Drosophila_2:1632696_at:305:225; Interrogation_Position=187; Antisense; AAGGACCTGAAAGATCTGATTGCCC
>probe:Drosophila_2:1632696_at:480:393; Interrogation_Position=195; Antisense; GAAAGATCTGATTGCCCTGAATGAG
>probe:Drosophila_2:1632696_at:93:243; Interrogation_Position=229; Antisense; AATAGGCTGTTATTCGATCGCCTCC
>probe:Drosophila_2:1632696_at:647:87; Interrogation_Position=23; Antisense; AGTCGAACGCGGATGCGAAGGCATC
>probe:Drosophila_2:1632696_at:456:449; Interrogation_Position=244; Antisense; GATCGCCTCCTGGATGTAATCAGAG
>probe:Drosophila_2:1632696_at:493:375; Interrogation_Position=277; Antisense; GAAGAAAAGCTACATTTGCCGAAGA
>probe:Drosophila_2:1632696_at:418:667; Interrogation_Position=61; Antisense; TACATGACGAGCGAGGATCCTGAGC
>probe:Drosophila_2:1632696_at:438:631; Interrogation_Position=78; Antisense; TCCTGAGCAGCCAAGTGAATCGTCC
>probe:Drosophila_2:1632696_at:658:509; Interrogation_Position=92; Antisense; GTGAATCGTCCACCCAGAAGGAGAA

Paste this into a BLAST search page for me
AAGGGTTCGCAGTCTTCAGAGTCCGTTCGCAGTCTTCAGAGTCCGAGGAAATACTTTAAGAATGTGTCCGAGCGCGAATGTGTCCGAGCGCTTCGATAAGCCGAGCGCTTCGATAAGGACATAAAAAGGACCTGAAAGATCTGATTGCCCGAAAGATCTGATTGCCCTGAATGAGAATAGGCTGTTATTCGATCGCCTCCAGTCGAACGCGGATGCGAAGGCATCGATCGCCTCCTGGATGTAATCAGAGGAAGAAAAGCTACATTTGCCGAAGATACATGACGAGCGAGGATCCTGAGCTCCTGAGCAGCCAAGTGAATCGTCCGTGAATCGTCCACCCAGAAGGAGAA

Full Affymetrix probeset data:

Annotations for 1632696_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720