FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632698_at:

>probe:Drosophila_2:1632698_at:385:315; Interrogation_Position=4151; Antisense; GCCATTTGAGAAAGCCAGCTGCGGT
>probe:Drosophila_2:1632698_at:9:359; Interrogation_Position=4188; Antisense; GCAAGCAGCTTGAGTGGTATTACAC
>probe:Drosophila_2:1632698_at:450:519; Interrogation_Position=4201; Antisense; GTGGTATTACACGTGCTTCTAAGCA
>probe:Drosophila_2:1632698_at:221:1; Interrogation_Position=4228; Antisense; AGCCCAACCCAATCGAAACTAATCG
>probe:Drosophila_2:1632698_at:68:637; Interrogation_Position=4250; Antisense; TCGAATCCTAGCCTCCTTTAAAAAT
>probe:Drosophila_2:1632698_at:20:167; Interrogation_Position=4271; Antisense; AAATGTACACTATCCAAACCGCAAC
>probe:Drosophila_2:1632698_at:640:39; Interrogation_Position=4301; Antisense; ATCGACGACAGTATTCCCGGAAAAT
>probe:Drosophila_2:1632698_at:408:459; Interrogation_Position=4398; Antisense; GATATATACATCGTACTCCCGTACA
>probe:Drosophila_2:1632698_at:603:17; Interrogation_Position=4470; Antisense; ATTTAGGCGCATACCCATTAAGTGG
>probe:Drosophila_2:1632698_at:343:53; Interrogation_Position=4510; Antisense; ATGCATGCCAAAGCTTACCACTTAG
>probe:Drosophila_2:1632698_at:96:253; Interrogation_Position=4564; Antisense; CAAGTTTGCAATGGTCTGCGGAGTA
>probe:Drosophila_2:1632698_at:716:571; Interrogation_Position=4595; Antisense; GGCGAAGTATTCCAATGTAGATCCA
>probe:Drosophila_2:1632698_at:301:227; Interrogation_Position=4627; Antisense; AATGTAAATTACTCGCTGTTCCCCA
>probe:Drosophila_2:1632698_at:256:333; Interrogation_Position=4641; Antisense; GCTGTTCCCCATAAAGCGAGCAATT

Paste this into a BLAST search page for me
GCCATTTGAGAAAGCCAGCTGCGGTGCAAGCAGCTTGAGTGGTATTACACGTGGTATTACACGTGCTTCTAAGCAAGCCCAACCCAATCGAAACTAATCGTCGAATCCTAGCCTCCTTTAAAAATAAATGTACACTATCCAAACCGCAACATCGACGACAGTATTCCCGGAAAATGATATATACATCGTACTCCCGTACAATTTAGGCGCATACCCATTAAGTGGATGCATGCCAAAGCTTACCACTTAGCAAGTTTGCAATGGTCTGCGGAGTAGGCGAAGTATTCCAATGTAGATCCAAATGTAAATTACTCGCTGTTCCCCAGCTGTTCCCCATAAAGCGAGCAATT

Full Affymetrix probeset data:

Annotations for 1632698_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720