Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632700_a_at:

>probe:Drosophila_2:1632700_a_at:436:447; Interrogation_Position=472; Antisense; GATGCCCTGCTGCATATTTACCGGA
>probe:Drosophila_2:1632700_a_at:273:67; Interrogation_Position=500; Antisense; ATGGCATTTCAGGATTCTGGCGCGC
>probe:Drosophila_2:1632700_a_at:39:577; Interrogation_Position=518; Antisense; GGCGCGCTGCTTTACCAAGCTTGAA
>probe:Drosophila_2:1632700_a_at:631:115; Interrogation_Position=535; Antisense; AGCTTGAACCGAACGCTTGTGGCCT
>probe:Drosophila_2:1632700_a_at:634:727; Interrogation_Position=551; Antisense; TTGTGGCCTCCAGTGTACAGATCGG
>probe:Drosophila_2:1632700_a_at:181:175; Interrogation_Position=586; Antisense; AAAGCCAAGTCCCTTCTGAAGGATA
>probe:Drosophila_2:1632700_a_at:680:453; Interrogation_Position=607; Antisense; GATAAAGGCTGGATCACCCATCCGG
>probe:Drosophila_2:1632700_a_at:147:637; Interrogation_Position=661; Antisense; TCGGGAACCCTTGTGGCAGTGGCCA
>probe:Drosophila_2:1632700_a_at:219:727; Interrogation_Position=695; Antisense; TTGATGTGCTCACCACACGGATGTA
>probe:Drosophila_2:1632700_a_at:722:217; Interrogation_Position=760; Antisense; AAGGGCTTGGTGGACTGTTTCACTA
>probe:Drosophila_2:1632700_a_at:206:23; Interrogation_Position=835; Antisense; ATATACTTTCGTAGTGCTCCACACA
>probe:Drosophila_2:1632700_a_at:604:93; Interrogation_Position=887; Antisense; AGTTGCTCCATTTGCGAGATCGTTA
>probe:Drosophila_2:1632700_a_at:214:427; Interrogation_Position=902; Antisense; GAGATCGTTATGTTTTCTCCCAGCG
>probe:Drosophila_2:1632700_a_at:39:215; Interrogation_Position=936; Antisense; AAGAGTCCAGTCCTCATGGAGCCAA

Paste this into a BLAST search page for me
GATGCCCTGCTGCATATTTACCGGAATGGCATTTCAGGATTCTGGCGCGCGGCGCGCTGCTTTACCAAGCTTGAAAGCTTGAACCGAACGCTTGTGGCCTTTGTGGCCTCCAGTGTACAGATCGGAAAGCCAAGTCCCTTCTGAAGGATAGATAAAGGCTGGATCACCCATCCGGTCGGGAACCCTTGTGGCAGTGGCCATTGATGTGCTCACCACACGGATGTAAAGGGCTTGGTGGACTGTTTCACTAATATACTTTCGTAGTGCTCCACACAAGTTGCTCCATTTGCGAGATCGTTAGAGATCGTTATGTTTTCTCCCAGCGAAGAGTCCAGTCCTCATGGAGCCAA

Full Affymetrix probeset data:

Annotations for 1632700_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime