Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632702_at:

>probe:Drosophila_2:1632702_at:318:507; Interrogation_Position=100; Antisense; GTGCCCTTCAACGACTCTGAGGTGA
>probe:Drosophila_2:1632702_at:312:607; Interrogation_Position=117; Antisense; TGAGGTGACCTGCATCCTGATGATC
>probe:Drosophila_2:1632702_at:333:475; Interrogation_Position=150; Antisense; GTATAGTCTCCAGAATGGGCCCTCT
>probe:Drosophila_2:1632702_at:348:661; Interrogation_Position=185; Antisense; TAACATCCAGCCAGTTTGTGAACAT
>probe:Drosophila_2:1632702_at:190:275; Interrogation_Position=207; Antisense; CATTGTGATCGGTTTCCAGCAGCTA
>probe:Drosophila_2:1632702_at:693:591; Interrogation_Position=245; Antisense; TGGTGGATCGCATCGTAACCCTAAT
>probe:Drosophila_2:1632702_at:9:75; Interrogation_Position=280; Antisense; AGGAAACACGTGACGCCCATGGAAT
>probe:Drosophila_2:1632702_at:399:153; Interrogation_Position=314; Antisense; ACATGACCATTCTAATGTCCCGCGA
>probe:Drosophila_2:1632702_at:483:453; Interrogation_Position=405; Antisense; GATCATTTCATCTTCGGTCGAGAGG
>probe:Drosophila_2:1632702_at:415:637; Interrogation_Position=422; Antisense; TCGAGAGGTTTTTCGTCGGCGACGA
>probe:Drosophila_2:1632702_at:393:49; Interrogation_Position=475; Antisense; ATGGTCGATTTTCTACTCCTCAAAT
>probe:Drosophila_2:1632702_at:502:103; Interrogation_Position=507; Antisense; AGACCAAGACGGCTACATCTCATTT
>probe:Drosophila_2:1632702_at:638:97; Interrogation_Position=541; Antisense; AGATCGATCGTGTTGCAGCAGCCGC
>probe:Drosophila_2:1632702_at:165:687; Interrogation_Position=638; Antisense; TATACTCTCACATACCCGAAATGGG

Paste this into a BLAST search page for me
GTGCCCTTCAACGACTCTGAGGTGATGAGGTGACCTGCATCCTGATGATCGTATAGTCTCCAGAATGGGCCCTCTTAACATCCAGCCAGTTTGTGAACATCATTGTGATCGGTTTCCAGCAGCTATGGTGGATCGCATCGTAACCCTAATAGGAAACACGTGACGCCCATGGAATACATGACCATTCTAATGTCCCGCGAGATCATTTCATCTTCGGTCGAGAGGTCGAGAGGTTTTTCGTCGGCGACGAATGGTCGATTTTCTACTCCTCAAATAGACCAAGACGGCTACATCTCATTTAGATCGATCGTGTTGCAGCAGCCGCTATACTCTCACATACCCGAAATGGG

Full Affymetrix probeset data:

Annotations for 1632702_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime