FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632703_at:

>probe:Drosophila_2:1632703_at:431:101; Interrogation_Position=1011; Antisense; AGAGCACGGATCATTTCTACCATCC
>probe:Drosophila_2:1632703_at:84:485; Interrogation_Position=1037; Antisense; GTATGCAGTCGCACTTAGTTCGTTT
>probe:Drosophila_2:1632703_at:19:679; Interrogation_Position=1052; Antisense; TAGTTCGTTTTCATTCGTGGCACTC
>probe:Drosophila_2:1632703_at:606:639; Interrogation_Position=1066; Antisense; TCGTGGCACTCATCGCTTACAAAAT
>probe:Drosophila_2:1632703_at:114:337; Interrogation_Position=546; Antisense; GCTGCGGCCAGGGAAAGCTGCTATT
>probe:Drosophila_2:1632703_at:354:161; Interrogation_Position=606; Antisense; ACAAGTGCACTGTGGACCGACCGTC
>probe:Drosophila_2:1632703_at:330:413; Interrogation_Position=624; Antisense; GACCGTCCAATAAGATGCTGGCCTT
>probe:Drosophila_2:1632703_at:472:321; Interrogation_Position=675; Antisense; GCACCATTCCGCAGGGTAACAATTT
>probe:Drosophila_2:1632703_at:365:701; Interrogation_Position=697; Antisense; TTTTGTGCTCTACGAAGGTTTCTTC
>probe:Drosophila_2:1632703_at:513:509; Interrogation_Position=739; Antisense; GTGCAAATCTGCAAGCGGACTCCAG
>probe:Drosophila_2:1632703_at:616:551; Interrogation_Position=789; Antisense; GGAGCCAGGGACATTACGTGCGCCA
>probe:Drosophila_2:1632703_at:725:379; Interrogation_Position=868; Antisense; GAACGATGCAAATTCCGGACCCTTT
>probe:Drosophila_2:1632703_at:128:277; Interrogation_Position=885; Antisense; GACCCTTTAGGCAGGACCAGAAAAT
>probe:Drosophila_2:1632703_at:156:43; Interrogation_Position=922; Antisense; ATCGATCTATCGACGTCGCTGGAAA

Paste this into a BLAST search page for me
AGAGCACGGATCATTTCTACCATCCGTATGCAGTCGCACTTAGTTCGTTTTAGTTCGTTTTCATTCGTGGCACTCTCGTGGCACTCATCGCTTACAAAATGCTGCGGCCAGGGAAAGCTGCTATTACAAGTGCACTGTGGACCGACCGTCGACCGTCCAATAAGATGCTGGCCTTGCACCATTCCGCAGGGTAACAATTTTTTTGTGCTCTACGAAGGTTTCTTCGTGCAAATCTGCAAGCGGACTCCAGGGAGCCAGGGACATTACGTGCGCCAGAACGATGCAAATTCCGGACCCTTTGACCCTTTAGGCAGGACCAGAAAATATCGATCTATCGACGTCGCTGGAAA

Full Affymetrix probeset data:

Annotations for 1632703_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720