Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632705_at:

>probe:Drosophila_2:1632705_at:43:705; Interrogation_Position=1148; Antisense; TTATGGCAGCACGATAAGCGGCTAC
>probe:Drosophila_2:1632705_at:253:433; Interrogation_Position=1225; Antisense; GAGTGCCGTTGAAGGTCAATGCCAA
>probe:Drosophila_2:1632705_at:130:459; Interrogation_Position=1256; Antisense; GATTACCTTGTACATAGAGCCAGAC
>probe:Drosophila_2:1632705_at:425:415; Interrogation_Position=1272; Antisense; GAGCCAGACAGCGTTATAGACATAC
>probe:Drosophila_2:1632705_at:115:27; Interrogation_Position=1287; Antisense; ATAGACATACTGAAGGGCCTGCCCA
>probe:Drosophila_2:1632705_at:191:117; Interrogation_Position=1311; Antisense; AGCTTCTATGCACCACTTTTTACCA
>probe:Drosophila_2:1632705_at:340:699; Interrogation_Position=1327; Antisense; TTTTTACCACTGCTAGTCGAGCGGA
>probe:Drosophila_2:1632705_at:253:417; Interrogation_Position=1345; Antisense; GAGCGGAAATCGACGAAGCCCTCGC
>probe:Drosophila_2:1632705_at:585:203; Interrogation_Position=1360; Antisense; AAGCCCTCGCCTCAGAACTTAGGTT
>probe:Drosophila_2:1632705_at:201:467; Interrogation_Position=1382; Antisense; GTTGGCACTGAATCTACCGGCTATA
>probe:Drosophila_2:1632705_at:426:669; Interrogation_Position=1415; Antisense; TACTGGAGTGGGATTCCTGTGCCTG
>probe:Drosophila_2:1632705_at:260:507; Interrogation_Position=1433; Antisense; GTGCCTGGGCTGCATTCTTATAGCA
>probe:Drosophila_2:1632705_at:362:351; Interrogation_Position=1455; Antisense; GCAGTTGGCATCTTACTTACCATTA
>probe:Drosophila_2:1632705_at:212:467; Interrogation_Position=1505; Antisense; GTTGGACAAACTGGCTCTCAAGGAT

Paste this into a BLAST search page for me
TTATGGCAGCACGATAAGCGGCTACGAGTGCCGTTGAAGGTCAATGCCAAGATTACCTTGTACATAGAGCCAGACGAGCCAGACAGCGTTATAGACATACATAGACATACTGAAGGGCCTGCCCAAGCTTCTATGCACCACTTTTTACCATTTTTACCACTGCTAGTCGAGCGGAGAGCGGAAATCGACGAAGCCCTCGCAAGCCCTCGCCTCAGAACTTAGGTTGTTGGCACTGAATCTACCGGCTATATACTGGAGTGGGATTCCTGTGCCTGGTGCCTGGGCTGCATTCTTATAGCAGCAGTTGGCATCTTACTTACCATTAGTTGGACAAACTGGCTCTCAAGGAT

Full Affymetrix probeset data:

Annotations for 1632705_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime