Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632706_at:

>probe:Drosophila_2:1632706_at:217:455; Interrogation_Position=380; Antisense; GATACTCGCCCGGTCTGGATTACTA
>probe:Drosophila_2:1632706_at:630:13; Interrogation_Position=398; Antisense; ATTACTACGATCAGCAGGGACACAT
>probe:Drosophila_2:1632706_at:476:155; Interrogation_Position=417; Antisense; ACACATCTATGTGGAGGCTGTCTAC
>probe:Drosophila_2:1632706_at:299:439; Interrogation_Position=430; Antisense; GAGGCTGTCTACAGACCCGGCAGTG
>probe:Drosophila_2:1632706_at:667:45; Interrogation_Position=470; Antisense; ATCCGCAGCTGCACTTCGAGGAAGA
>probe:Drosophila_2:1632706_at:706:717; Interrogation_Position=597; Antisense; TTCCGCCAAGTCATCGGGACTGCAT
>probe:Drosophila_2:1632706_at:172:405; Interrogation_Position=614; Antisense; GACTGCATCTCAGCCGAATTTCCAT
>probe:Drosophila_2:1632706_at:324:31; Interrogation_Position=665; Antisense; ATCACTTCTCCAGTCCGACGGGAAA
>probe:Drosophila_2:1632706_at:406:291; Interrogation_Position=683; Antisense; CGGGAAATGCATCGATGCGCTCGTT
>probe:Drosophila_2:1632706_at:43:211; Interrogation_Position=739; Antisense; AAGAAATCCCTGTCGCCGAACAACT
>probe:Drosophila_2:1632706_at:575:313; Interrogation_Position=858; Antisense; GCCAGTCCAGTACGTCTACATGAAG
>probe:Drosophila_2:1632706_at:155:407; Interrogation_Position=893; Antisense; GACTGTATTCCCGAGTGCCCAGCTA
>probe:Drosophila_2:1632706_at:16:117; Interrogation_Position=913; Antisense; AGCTATGCGGTCTGCTATCCGTATA
>probe:Drosophila_2:1632706_at:702:683; Interrogation_Position=928; Antisense; TATCCGTATACCCTACAGCACATGT

Paste this into a BLAST search page for me
GATACTCGCCCGGTCTGGATTACTAATTACTACGATCAGCAGGGACACATACACATCTATGTGGAGGCTGTCTACGAGGCTGTCTACAGACCCGGCAGTGATCCGCAGCTGCACTTCGAGGAAGATTCCGCCAAGTCATCGGGACTGCATGACTGCATCTCAGCCGAATTTCCATATCACTTCTCCAGTCCGACGGGAAACGGGAAATGCATCGATGCGCTCGTTAAGAAATCCCTGTCGCCGAACAACTGCCAGTCCAGTACGTCTACATGAAGGACTGTATTCCCGAGTGCCCAGCTAAGCTATGCGGTCTGCTATCCGTATATATCCGTATACCCTACAGCACATGT

Full Affymetrix probeset data:

Annotations for 1632706_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime