FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632707_at:

>probe:Drosophila_2:1632707_at:459:83; Interrogation_Position=110; Antisense; AGGGCTGCTCCAATCACCACCTGAT
>probe:Drosophila_2:1632707_at:611:449; Interrogation_Position=132; Antisense; GATCGCCGACAATCTGAACTGGTTC
>probe:Drosophila_2:1632707_at:476:617; Interrogation_Position=14; Antisense; TGCAGCTGATCTACACCTGCAAGGT
>probe:Drosophila_2:1632707_at:345:383; Interrogation_Position=147; Antisense; GAACTGGTTCACAGATCTGGACGGC
>probe:Drosophila_2:1632707_at:484:41; Interrogation_Position=161; Antisense; ATCTGGACGGCAAGCGCAACATCGA
>probe:Drosophila_2:1632707_at:637:293; Interrogation_Position=207; Antisense; CGAGAAGGTGGTTCGCCTGACCGAT
>probe:Drosophila_2:1632707_at:455:285; Interrogation_Position=223; Antisense; CTGACCGATGGCAACTGCGAGTTTT
>probe:Drosophila_2:1632707_at:620:193; Interrogation_Position=235; Antisense; AACTGCGAGTTTTTGCCGAAACATG
>probe:Drosophila_2:1632707_at:506:361; Interrogation_Position=32; Antisense; GCAAGGTGTGCCAGACCCGGAACAT
>probe:Drosophila_2:1632707_at:414:411; Interrogation_Position=45; Antisense; GACCCGGAACATGAAGACCATTTCG
>probe:Drosophila_2:1632707_at:15:415; Interrogation_Position=60; Antisense; GACCATTTCGAAGCTGGCATACCAA
>probe:Drosophila_2:1632707_at:452:377; Interrogation_Position=69; Antisense; GAAGCTGGCATACCAACGCGGCGTT
>probe:Drosophila_2:1632707_at:179:201; Interrogation_Position=83; Antisense; AACGCGGCGTTGTTATCGTGACCTG
>probe:Drosophila_2:1632707_at:323:703; Interrogation_Position=95; Antisense; TTATCGTGACCTGCGAGGGCTGCTC

Paste this into a BLAST search page for me
AGGGCTGCTCCAATCACCACCTGATGATCGCCGACAATCTGAACTGGTTCTGCAGCTGATCTACACCTGCAAGGTGAACTGGTTCACAGATCTGGACGGCATCTGGACGGCAAGCGCAACATCGACGAGAAGGTGGTTCGCCTGACCGATCTGACCGATGGCAACTGCGAGTTTTAACTGCGAGTTTTTGCCGAAACATGGCAAGGTGTGCCAGACCCGGAACATGACCCGGAACATGAAGACCATTTCGGACCATTTCGAAGCTGGCATACCAAGAAGCTGGCATACCAACGCGGCGTTAACGCGGCGTTGTTATCGTGACCTGTTATCGTGACCTGCGAGGGCTGCTC

Full Affymetrix probeset data:

Annotations for 1632707_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720