FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632708_at:

>probe:Drosophila_2:1632708_at:526:525; Interrogation_Position=1175; Antisense; GGGAATTACTCTTGGCCCTGTCGAT
>probe:Drosophila_2:1632708_at:705:577; Interrogation_Position=1188; Antisense; GGCCCTGTCGATCACTTGCAGGAAA
>probe:Drosophila_2:1632708_at:50:281; Interrogation_Position=1240; Antisense; CTCGGCGGCGAGGTATTCGACGAAA
>probe:Drosophila_2:1632708_at:376:29; Interrogation_Position=1284; Antisense; ATACTTCAAGCTGCAGACTCTCAAC
>probe:Drosophila_2:1632708_at:150:171; Interrogation_Position=1358; Antisense; AAAGTCTCAGGAACTTCTGGCGCCG
>probe:Drosophila_2:1632708_at:10:441; Interrogation_Position=1389; Antisense; GATGGCCGAAGCTCAAAACCTGCTG
>probe:Drosophila_2:1632708_at:311:423; Interrogation_Position=1423; Antisense; GAGAAGCGTCGCCTCACTGAGGACA
>probe:Drosophila_2:1632708_at:281:649; Interrogation_Position=1449; Antisense; TCAGCGCCTGATCGACTTTATCAAA
>probe:Drosophila_2:1632708_at:56:35; Interrogation_Position=1468; Antisense; ATCAAATCCATGAGTGTCACCGAGG
>probe:Drosophila_2:1632708_at:317:563; Interrogation_Position=1497; Antisense; GGAAGAGCTGCGAACCGCCATGCAT
>probe:Drosophila_2:1632708_at:581:269; Interrogation_Position=1515; Antisense; CATGCATGTTTCATCGCCAACTCAA
>probe:Drosophila_2:1632708_at:288:49; Interrogation_Position=1543; Antisense; ATGCCACCCAAACTTTTCGAGACAA
>probe:Drosophila_2:1632708_at:248:171; Interrogation_Position=1590; Antisense; AAAGGTCGTGCATTCACCGACGGCA
>probe:Drosophila_2:1632708_at:304:517; Interrogation_Position=1629; Antisense; GTGGGAGGCCGAAGCCACTTTGAAT

Paste this into a BLAST search page for me
GGGAATTACTCTTGGCCCTGTCGATGGCCCTGTCGATCACTTGCAGGAAACTCGGCGGCGAGGTATTCGACGAAAATACTTCAAGCTGCAGACTCTCAACAAAGTCTCAGGAACTTCTGGCGCCGGATGGCCGAAGCTCAAAACCTGCTGGAGAAGCGTCGCCTCACTGAGGACATCAGCGCCTGATCGACTTTATCAAAATCAAATCCATGAGTGTCACCGAGGGGAAGAGCTGCGAACCGCCATGCATCATGCATGTTTCATCGCCAACTCAAATGCCACCCAAACTTTTCGAGACAAAAAGGTCGTGCATTCACCGACGGCAGTGGGAGGCCGAAGCCACTTTGAAT

Full Affymetrix probeset data:

Annotations for 1632708_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720