FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632711_at:

>probe:Drosophila_2:1632711_at:722:61; Interrogation_Position=480; Antisense; AGGCAATCTCCCAGCTACGTAAAGG
>probe:Drosophila_2:1632711_at:308:491; Interrogation_Position=498; Antisense; GTAAAGGCCCTGCACAAGTCTCTAT
>probe:Drosophila_2:1632711_at:281:219; Interrogation_Position=513; Antisense; AAGTCTCTATTCTACTTGGACGCCA
>probe:Drosophila_2:1632711_at:411:111; Interrogation_Position=537; Antisense; AGCAAGTACCAGCTGTCCAAGCGCA
>probe:Drosophila_2:1632711_at:346:193; Interrogation_Position=573; Antisense; AACTACGTACTAATCCGTCACTGGC
>probe:Drosophila_2:1632711_at:678:363; Interrogation_Position=606; Antisense; GAATTCTCGCTGTACGGCTACAAGA
>probe:Drosophila_2:1632711_at:329:455; Interrogation_Position=629; Antisense; GATACTGGGCGTAATCACTTTCCTG
>probe:Drosophila_2:1632711_at:95:35; Interrogation_Position=642; Antisense; ATCACTTTCCTGCAGGTCAGCGTTT
>probe:Drosophila_2:1632711_at:116:365; Interrogation_Position=743; Antisense; GAATTTCCTGCAAAGATCTTCGAGT
>probe:Drosophila_2:1632711_at:314:153; Interrogation_Position=794; Antisense; ACAGTGCATCCTTTGCCTGGAGCCA
>probe:Drosophila_2:1632711_at:400:585; Interrogation_Position=811; Antisense; TGGAGCCACGTTCTGACAGCAGTTT
>probe:Drosophila_2:1632711_at:476:611; Interrogation_Position=824; Antisense; TGACAGCAGTTTGACTCCATGCGGC
>probe:Drosophila_2:1632711_at:321:51; Interrogation_Position=842; Antisense; ATGCGGCCACATCTTTTGCTGGAGC
>probe:Drosophila_2:1632711_at:60:307; Interrogation_Position=904; Antisense; CCTTGTGCCGGGAGTCGCTGAAAAA

Paste this into a BLAST search page for me
AGGCAATCTCCCAGCTACGTAAAGGGTAAAGGCCCTGCACAAGTCTCTATAAGTCTCTATTCTACTTGGACGCCAAGCAAGTACCAGCTGTCCAAGCGCAAACTACGTACTAATCCGTCACTGGCGAATTCTCGCTGTACGGCTACAAGAGATACTGGGCGTAATCACTTTCCTGATCACTTTCCTGCAGGTCAGCGTTTGAATTTCCTGCAAAGATCTTCGAGTACAGTGCATCCTTTGCCTGGAGCCATGGAGCCACGTTCTGACAGCAGTTTTGACAGCAGTTTGACTCCATGCGGCATGCGGCCACATCTTTTGCTGGAGCCCTTGTGCCGGGAGTCGCTGAAAAA

Full Affymetrix probeset data:

Annotations for 1632711_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720