Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632713_at:

>probe:Drosophila_2:1632713_at:457:241; Interrogation_Position=1775; Antisense; AATACTTGTTCAATCGTCGTGGCCG
>probe:Drosophila_2:1632713_at:100:501; Interrogation_Position=1790; Antisense; GTCGTGGCCGATAGAAATATCTTAC
>probe:Drosophila_2:1632713_at:198:585; Interrogation_Position=1833; Antisense; TGGAATTGGTCTGCAACTGGTCGCC
>probe:Drosophila_2:1632713_at:365:143; Interrogation_Position=1848; Antisense; ACTGGTCGCCTTCATTTCGTAAAAT
>probe:Drosophila_2:1632713_at:526:693; Interrogation_Position=1862; Antisense; TTTCGTAAAATGTTCGCTTGCGGCC
>probe:Drosophila_2:1632713_at:500:633; Interrogation_Position=1875; Antisense; TCGCTTGCGGCCGAAAAATTTCGAT
>probe:Drosophila_2:1632713_at:498:561; Interrogation_Position=1942; Antisense; GGAACACTTTGAATTTCGAACTGTC
>probe:Drosophila_2:1632713_at:605:383; Interrogation_Position=1959; Antisense; GAACTGTCAATCGTATCATTAGAAT
>probe:Drosophila_2:1632713_at:260:105; Interrogation_Position=2016; Antisense; AGCAAGGAACACTTTCGTCGTCGGC
>probe:Drosophila_2:1632713_at:212:639; Interrogation_Position=2033; Antisense; TCGTCGGCTACGCATTCATTGTAAA
>probe:Drosophila_2:1632713_at:197:403; Interrogation_Position=2070; Antisense; GACATTCCGCACTTTTTGATAGATA
>probe:Drosophila_2:1632713_at:555:269; Interrogation_Position=2115; Antisense; CATGTATCGCAAGTATTCATTTCAA
>probe:Drosophila_2:1632713_at:59:713; Interrogation_Position=2233; Antisense; TTCACACATGAAACAACCGCCAGCA
>probe:Drosophila_2:1632713_at:289:613; Interrogation_Position=2308; Antisense; TGAAAAATTCAATGGCTCGAGTGCC

Paste this into a BLAST search page for me
AATACTTGTTCAATCGTCGTGGCCGGTCGTGGCCGATAGAAATATCTTACTGGAATTGGTCTGCAACTGGTCGCCACTGGTCGCCTTCATTTCGTAAAATTTTCGTAAAATGTTCGCTTGCGGCCTCGCTTGCGGCCGAAAAATTTCGATGGAACACTTTGAATTTCGAACTGTCGAACTGTCAATCGTATCATTAGAATAGCAAGGAACACTTTCGTCGTCGGCTCGTCGGCTACGCATTCATTGTAAAGACATTCCGCACTTTTTGATAGATACATGTATCGCAAGTATTCATTTCAATTCACACATGAAACAACCGCCAGCATGAAAAATTCAATGGCTCGAGTGCC

Full Affymetrix probeset data:

Annotations for 1632713_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime