FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632714_at:

>probe:Drosophila_2:1632714_at:423:605; Interrogation_Position=117; Antisense; TGATCATGTTGGAGGCCACCTTGCA
>probe:Drosophila_2:1632714_at:664:461; Interrogation_Position=218; Antisense; GATTATCTGATCGTTGTCCTGGCAT
>probe:Drosophila_2:1632714_at:689:19; Interrogation_Position=248; Antisense; ATTTGCACCCAGTTCTTGCTGATGA
>probe:Drosophila_2:1632714_at:34:607; Interrogation_Position=267; Antisense; TGATGACCTATGTGGCGTTCGCAGT
>probe:Drosophila_2:1632714_at:178:55; Interrogation_Position=293; Antisense; ATGCAACCGTGTTCCATGCGAAGGA
>probe:Drosophila_2:1632714_at:317:171; Interrogation_Position=340; Antisense; AAAGACCTTCGCTAGCTTCATATTC
>probe:Drosophila_2:1632714_at:402:371; Interrogation_Position=366; Antisense; GAAGGTTACTCTTCCAGTTGGACGA
>probe:Drosophila_2:1632714_at:116:93; Interrogation_Position=381; Antisense; AGTTGGACGAGGCATTACACCCTTC
>probe:Drosophila_2:1632714_at:341:405; Interrogation_Position=425; Antisense; GACTCCTGCTTGAGGTCTGGTGAAA
>probe:Drosophila_2:1632714_at:334:195; Interrogation_Position=468; Antisense; AACTGTTCCGGCGAGATGCTCTCAA
>probe:Drosophila_2:1632714_at:13:79; Interrogation_Position=492; Antisense; AGGTCCTTCAGCCAGTGCAGAATAT
>probe:Drosophila_2:1632714_at:342:111; Interrogation_Position=510; Antisense; AGAATATCTCATCCGCAATGGCCAG
>probe:Drosophila_2:1632714_at:369:197; Interrogation_Position=581; Antisense; AACGGCTATGGGAGCTCTCATTCAA
>probe:Drosophila_2:1632714_at:43:461; Interrogation_Position=87; Antisense; GATTTGTTGACTCGGTGATCCTTGA

Paste this into a BLAST search page for me
TGATCATGTTGGAGGCCACCTTGCAGATTATCTGATCGTTGTCCTGGCATATTTGCACCCAGTTCTTGCTGATGATGATGACCTATGTGGCGTTCGCAGTATGCAACCGTGTTCCATGCGAAGGAAAAGACCTTCGCTAGCTTCATATTCGAAGGTTACTCTTCCAGTTGGACGAAGTTGGACGAGGCATTACACCCTTCGACTCCTGCTTGAGGTCTGGTGAAAAACTGTTCCGGCGAGATGCTCTCAAAGGTCCTTCAGCCAGTGCAGAATATAGAATATCTCATCCGCAATGGCCAGAACGGCTATGGGAGCTCTCATTCAAGATTTGTTGACTCGGTGATCCTTGA

Full Affymetrix probeset data:

Annotations for 1632714_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720