FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632716_at:

>probe:Drosophila_2:1632716_at:21:171; Interrogation_Position=112; Antisense; AAAGGTGGATGCTCGCACCTACGGA
>probe:Drosophila_2:1632716_at:188:353; Interrogation_Position=126; Antisense; GCACCTACGGATTCCTGAAGACCAA
>probe:Drosophila_2:1632716_at:274:223; Interrogation_Position=149; Antisense; AAGGGATCAGATACGCCGATGCCCA
>probe:Drosophila_2:1632716_at:235:51; Interrogation_Position=167; Antisense; ATGCCCACGGCTGCGAAGAGAATTA
>probe:Drosophila_2:1632716_at:322:435; Interrogation_Position=248; Antisense; GAGGAAGATCAGTCGTCTACGGGTT
>probe:Drosophila_2:1632716_at:461:85; Interrogation_Position=258; Antisense; AGTCGTCTACGGGTTCAGTGGAATC
>probe:Drosophila_2:1632716_at:587:363; Interrogation_Position=278; Antisense; GAATCGGGTAGCATGTCCTTCGAAA
>probe:Drosophila_2:1632716_at:671:561; Interrogation_Position=309; Antisense; GGAAGCTATTTGACGCAGCCGAGTT
>probe:Drosophila_2:1632716_at:335:93; Interrogation_Position=330; Antisense; AGTTCACCATCACCCGAGGTCAGAA
>probe:Drosophila_2:1632716_at:587:389; Interrogation_Position=352; Antisense; GAAACTGAGTGACCTCACGCATGCC
>probe:Drosophila_2:1632716_at:243:697; Interrogation_Position=395; Antisense; TTTAGTCCGTACGATACCGGCAACA
>probe:Drosophila_2:1632716_at:445:457; Interrogation_Position=407; Antisense; GATACCGGCAACAAGACACTCGAAG
>probe:Drosophila_2:1632716_at:60:627; Interrogation_Position=446; Antisense; TGCCGCGCCGTCAACATTAAGTTTG
>probe:Drosophila_2:1632716_at:611:167; Interrogation_Position=57; Antisense; AAATGTCCCGATACTCCATGAAAGG

Paste this into a BLAST search page for me
AAAGGTGGATGCTCGCACCTACGGAGCACCTACGGATTCCTGAAGACCAAAAGGGATCAGATACGCCGATGCCCAATGCCCACGGCTGCGAAGAGAATTAGAGGAAGATCAGTCGTCTACGGGTTAGTCGTCTACGGGTTCAGTGGAATCGAATCGGGTAGCATGTCCTTCGAAAGGAAGCTATTTGACGCAGCCGAGTTAGTTCACCATCACCCGAGGTCAGAAGAAACTGAGTGACCTCACGCATGCCTTTAGTCCGTACGATACCGGCAACAGATACCGGCAACAAGACACTCGAAGTGCCGCGCCGTCAACATTAAGTTTGAAATGTCCCGATACTCCATGAAAGG

Full Affymetrix probeset data:

Annotations for 1632716_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720