Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632717_a_at:

>probe:Drosophila_2:1632717_a_at:30:461; Interrogation_Position=112; Antisense; GATTCGGATGCATACGACGGCTACC
>probe:Drosophila_2:1632717_a_at:216:127; Interrogation_Position=134; Antisense; ACCAACCACTCGCTTTGGATGAGGA
>probe:Drosophila_2:1632717_a_at:704:75; Interrogation_Position=197; Antisense; AGGAGACCCCGTCCGCGGATAATGA
>probe:Drosophila_2:1632717_a_at:124:215; Interrogation_Position=224; Antisense; AAGATGTTGACCTGATGACTGCCCC
>probe:Drosophila_2:1632717_a_at:368:109; Interrogation_Position=24; Antisense; AGAATTGCCCTCAGATCCCGGTCAA
>probe:Drosophila_2:1632717_a_at:251:5; Interrogation_Position=280; Antisense; ATTGAGCCCGCTGACGTGGAAATCG
>probe:Drosophila_2:1632717_a_at:600:527; Interrogation_Position=317; Antisense; GGAGTGAACCAAGACCCAGGGAACT
>probe:Drosophila_2:1632717_a_at:645:543; Interrogation_Position=348; Antisense; GGATCTTGACAAAACTCGAACGGAA
>probe:Drosophila_2:1632717_a_at:431:119; Interrogation_Position=384; Antisense; AGCGATGTCCACTATAACGTTACCC
>probe:Drosophila_2:1632717_a_at:582:29; Interrogation_Position=397; Antisense; ATAACGTTACCCAACATCACAGTGC
>probe:Drosophila_2:1632717_a_at:678:33; Interrogation_Position=412; Antisense; ATCACAGTGCCGGATTGGGCCAGAG
>probe:Drosophila_2:1632717_a_at:220:87; Interrogation_Position=438; Antisense; AGTGCCCGAGGAGCATTGGAAGCAT
>probe:Drosophila_2:1632717_a_at:76:347; Interrogation_Position=459; Antisense; GCATGAGCTGCTGGACCGGATTAAC
>probe:Drosophila_2:1632717_a_at:682:321; Interrogation_Position=522; Antisense; GCGCGAGAGTCATCAGCATTCCAAG

Paste this into a BLAST search page for me
GATTCGGATGCATACGACGGCTACCACCAACCACTCGCTTTGGATGAGGAAGGAGACCCCGTCCGCGGATAATGAAAGATGTTGACCTGATGACTGCCCCAGAATTGCCCTCAGATCCCGGTCAAATTGAGCCCGCTGACGTGGAAATCGGGAGTGAACCAAGACCCAGGGAACTGGATCTTGACAAAACTCGAACGGAAAGCGATGTCCACTATAACGTTACCCATAACGTTACCCAACATCACAGTGCATCACAGTGCCGGATTGGGCCAGAGAGTGCCCGAGGAGCATTGGAAGCATGCATGAGCTGCTGGACCGGATTAACGCGCGAGAGTCATCAGCATTCCAAG

Full Affymetrix probeset data:

Annotations for 1632717_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime