FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632719_at:

>probe:Drosophila_2:1632719_at:705:317; Interrogation_Position=172; Antisense; GCCGGTTGGCTGAAGAAACTTGGCA
>probe:Drosophila_2:1632719_at:502:149; Interrogation_Position=189; Antisense; ACTTGGCAAGAGAATCGAGCGCATT
>probe:Drosophila_2:1632719_at:344:251; Interrogation_Position=195; Antisense; CAAGAGAATCGAGCGCATTGGCCAG
>probe:Drosophila_2:1632719_at:539:3; Interrogation_Position=211; Antisense; ATTGGCCAGCACACCCGGGATGCAA
>probe:Drosophila_2:1632719_at:489:301; Interrogation_Position=224; Antisense; CCCGGGATGCAACCATTCAAGGACT
>probe:Drosophila_2:1632719_at:715:711; Interrogation_Position=239; Antisense; TTCAAGGACTGGGAATTGCGCAACA
>probe:Drosophila_2:1632719_at:40:93; Interrogation_Position=25; Antisense; AGTTTCCACAGCAGCTAAACAGCTA
>probe:Drosophila_2:1632719_at:501:265; Interrogation_Position=288; Antisense; CAGAGGATGAGCCTTTAATGTCCAT
>probe:Drosophila_2:1632719_at:659:59; Interrogation_Position=305; Antisense; ATGTCCATCAAAGGACTCTACCAGG
>probe:Drosophila_2:1632719_at:183:145; Interrogation_Position=319; Antisense; ACTCTACCAGGATAACGCGCGTTTA
>probe:Drosophila_2:1632719_at:201:133; Interrogation_Position=333; Antisense; ACGCGCGTTTAATTATACACACTTA
>probe:Drosophila_2:1632719_at:439:675; Interrogation_Position=373; Antisense; TAGAAATAAACTAGCTTACATCCCC
>probe:Drosophila_2:1632719_at:17:179; Interrogation_Position=41; Antisense; AAACAGCTAAATCGCAATCTATATA
>probe:Drosophila_2:1632719_at:728:173; Interrogation_Position=88; Antisense; AAACCTAGAAAATTCACCATGAACT

Paste this into a BLAST search page for me
GCCGGTTGGCTGAAGAAACTTGGCAACTTGGCAAGAGAATCGAGCGCATTCAAGAGAATCGAGCGCATTGGCCAGATTGGCCAGCACACCCGGGATGCAACCCGGGATGCAACCATTCAAGGACTTTCAAGGACTGGGAATTGCGCAACAAGTTTCCACAGCAGCTAAACAGCTACAGAGGATGAGCCTTTAATGTCCATATGTCCATCAAAGGACTCTACCAGGACTCTACCAGGATAACGCGCGTTTAACGCGCGTTTAATTATACACACTTATAGAAATAAACTAGCTTACATCCCCAAACAGCTAAATCGCAATCTATATAAAACCTAGAAAATTCACCATGAACT

Full Affymetrix probeset data:

Annotations for 1632719_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720