FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632720_at:

>probe:Drosophila_2:1632720_at:148:581; Interrogation_Position=111; Antisense; TGGCCAATATGGGTGTTTCTCGTGA
>probe:Drosophila_2:1632720_at:727:695; Interrogation_Position=126; Antisense; TTTCTCGTGACCAGTTGTCCAAGTG
>probe:Drosophila_2:1632720_at:37:57; Interrogation_Position=20; Antisense; ATGAGAGCCCTCCTAGGAATCTGTG
>probe:Drosophila_2:1632720_at:535:441; Interrogation_Position=212; Antisense; GATGGATCCAACGACTATGGCATTT
>probe:Drosophila_2:1632720_at:7:585; Interrogation_Position=229; Antisense; TGGCATTTTCCAGATCAACGACATG
>probe:Drosophila_2:1632720_at:364:653; Interrogation_Position=243; Antisense; TCAACGACATGTACTGGTGCCAGCC
>probe:Drosophila_2:1632720_at:711:589; Interrogation_Position=257; Antisense; TGGTGCCAGCCGTCCAGTGGAAAGT
>probe:Drosophila_2:1632720_at:577:171; Interrogation_Position=277; Antisense; AAAGTTCTCCCACAATGGCTGCGAT
>probe:Drosophila_2:1632720_at:128:63; Interrogation_Position=300; Antisense; ATGTGAGTTGCAACGCTCTCTTGAC
>probe:Drosophila_2:1632720_at:468:253; Interrogation_Position=334; Antisense; CAAAAGTTCCGTAAGATGTGCCCTA
>probe:Drosophila_2:1632720_at:201:61; Interrogation_Position=349; Antisense; ATGTGCCCTAAAGGTCCTGGGTCAA
>probe:Drosophila_2:1632720_at:28:565; Interrogation_Position=35; Antisense; GGAATCTGTGTCCTGGCACTAGTCA
>probe:Drosophila_2:1632720_at:281:301; Interrogation_Position=423; Antisense; CCCCGATCGATGATTGCTTTGTTTA
>probe:Drosophila_2:1632720_at:157:651; Interrogation_Position=95; Antisense; TCACTGGCGCGCGAGATGGCCAATA

Paste this into a BLAST search page for me
TGGCCAATATGGGTGTTTCTCGTGATTTCTCGTGACCAGTTGTCCAAGTGATGAGAGCCCTCCTAGGAATCTGTGGATGGATCCAACGACTATGGCATTTTGGCATTTTCCAGATCAACGACATGTCAACGACATGTACTGGTGCCAGCCTGGTGCCAGCCGTCCAGTGGAAAGTAAAGTTCTCCCACAATGGCTGCGATATGTGAGTTGCAACGCTCTCTTGACCAAAAGTTCCGTAAGATGTGCCCTAATGTGCCCTAAAGGTCCTGGGTCAAGGAATCTGTGTCCTGGCACTAGTCACCCCGATCGATGATTGCTTTGTTTATCACTGGCGCGCGAGATGGCCAATA

Full Affymetrix probeset data:

Annotations for 1632720_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720