FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632721_at:

>probe:Drosophila_2:1632721_at:570:7; Interrogation_Position=1040; Antisense; ATTCCATCCGGTGAAGGATCGCTCC
>probe:Drosophila_2:1632721_at:207:213; Interrogation_Position=1065; Antisense; AAGAGCCACCTCAGTTTGAGCACTG
>probe:Drosophila_2:1632721_at:462:73; Interrogation_Position=1099; Antisense; AGGAATCTGCCTTGAAGCGCTACCA
>probe:Drosophila_2:1632721_at:526:333; Interrogation_Position=1151; Antisense; GCTGGTTTCCTGTTCGGATGACAAC
>probe:Drosophila_2:1632721_at:264:157; Interrogation_Position=1174; Antisense; ACACCCTCTATCTGTGGCGGAACAA
>probe:Drosophila_2:1632721_at:206:467; Interrogation_Position=1212; Antisense; GTTGAGCGCATGACAGGGCACCAGA
>probe:Drosophila_2:1632721_at:311:407; Interrogation_Position=1248; Antisense; GACGTGAAATATTCGCCGGATGTAA
>probe:Drosophila_2:1632721_at:59:119; Interrogation_Position=1273; Antisense; AGCTAATTGCGTCTGCTTCATTTGA
>probe:Drosophila_2:1632721_at:459:161; Interrogation_Position=1297; Antisense; ACAAGTCAGTGCGTCTGTGGCGAGC
>probe:Drosophila_2:1632721_at:211:121; Interrogation_Position=1323; Antisense; AGCGATGGTCAGTACATGGCCACCT
>probe:Drosophila_2:1632721_at:320:63; Interrogation_Position=1357; Antisense; ATGTGCAGGCTGTTTACACGGTTGC
>probe:Drosophila_2:1632721_at:548:465; Interrogation_Position=1403; Antisense; GATTGTTTCCGGCAGCAAAGACTCA
>probe:Drosophila_2:1632721_at:379:153; Interrogation_Position=1466; Antisense; ACAGGAGCTGCCTGGACATGCGGAT
>probe:Drosophila_2:1632721_at:226:441; Interrogation_Position=1518; Antisense; GATGGCTCTAGAGTTGCCTCTGGTG

Paste this into a BLAST search page for me
ATTCCATCCGGTGAAGGATCGCTCCAAGAGCCACCTCAGTTTGAGCACTGAGGAATCTGCCTTGAAGCGCTACCAGCTGGTTTCCTGTTCGGATGACAACACACCCTCTATCTGTGGCGGAACAAGTTGAGCGCATGACAGGGCACCAGAGACGTGAAATATTCGCCGGATGTAAAGCTAATTGCGTCTGCTTCATTTGAACAAGTCAGTGCGTCTGTGGCGAGCAGCGATGGTCAGTACATGGCCACCTATGTGCAGGCTGTTTACACGGTTGCGATTGTTTCCGGCAGCAAAGACTCAACAGGAGCTGCCTGGACATGCGGATGATGGCTCTAGAGTTGCCTCTGGTG

Full Affymetrix probeset data:

Annotations for 1632721_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720