Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632722_x_at:

>probe:Drosophila_2:1632722_x_at:686:587; Interrogation_Position=14; Antisense; TGGAGCAACAACGTCTTCAACTGGC
>probe:Drosophila_2:1632722_x_at:216:187; Interrogation_Position=20; Antisense; AACAACGTCTTCAACTGGCCAGTAA
>probe:Drosophila_2:1632722_x_at:655:195; Interrogation_Position=23; Antisense; AACGTCTTCAACTGGCCAGTAAGTT
>probe:Drosophila_2:1632722_x_at:594:313; Interrogation_Position=37; Antisense; GCCAGTAAGTTGGATCGGAGTCAAA
>probe:Drosophila_2:1632722_x_at:169:359; Interrogation_Position=441; Antisense; GAAGAAGTAATTCAACGGACTGTGA
>probe:Drosophila_2:1632722_x_at:352:557; Interrogation_Position=457; Antisense; GGACTGTGAATCCTACGCCTCAATA
>probe:Drosophila_2:1632722_x_at:629:367; Interrogation_Position=464; Antisense; GAATCCTACGCCTCAATAACAAATT
>probe:Drosophila_2:1632722_x_at:488:549; Interrogation_Position=53; Antisense; GGAGTCAAAGACGTTGTGCTGCCAT
>probe:Drosophila_2:1632722_x_at:600:171; Interrogation_Position=59; Antisense; AAAGACGTTGTGCTGCCATGTCGAC
>probe:Drosophila_2:1632722_x_at:135:103; Interrogation_Position=61; Antisense; AGACGTTGTGCTGCCATGTCGACGA
>probe:Drosophila_2:1632722_x_at:322:727; Interrogation_Position=66; Antisense; TTGTGCTGCCATGTCGACGACGACA
>probe:Drosophila_2:1632722_x_at:363:409; Interrogation_Position=81; Antisense; GACGACGACAGCTGCATGTATCGCC
>probe:Drosophila_2:1632722_x_at:278:137; Interrogation_Position=85; Antisense; ACGACAGCTGCATGTATCGCCGTCT
>probe:Drosophila_2:1632722_x_at:308:119; Interrogation_Position=90; Antisense; AGCTGCATGTATCGCCGTCTGCTTC

Paste this into a BLAST search page for me
TGGAGCAACAACGTCTTCAACTGGCAACAACGTCTTCAACTGGCCAGTAAAACGTCTTCAACTGGCCAGTAAGTTGCCAGTAAGTTGGATCGGAGTCAAAGAAGAAGTAATTCAACGGACTGTGAGGACTGTGAATCCTACGCCTCAATAGAATCCTACGCCTCAATAACAAATTGGAGTCAAAGACGTTGTGCTGCCATAAAGACGTTGTGCTGCCATGTCGACAGACGTTGTGCTGCCATGTCGACGATTGTGCTGCCATGTCGACGACGACAGACGACGACAGCTGCATGTATCGCCACGACAGCTGCATGTATCGCCGTCTAGCTGCATGTATCGCCGTCTGCTTC

Full Affymetrix probeset data:

Annotations for 1632722_x_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime