FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632723_at:

>probe:Drosophila_2:1632723_at:26:149; Interrogation_Position=101; Antisense; ACTTCGATCCATTCCTTTACGGATT
>probe:Drosophila_2:1632723_at:377:693; Interrogation_Position=124; Antisense; TTTCTAATAGTGTTATCCTCGCCCA
>probe:Drosophila_2:1632723_at:171:109; Interrogation_Position=173; Antisense; AGAAGCTAGCCAAGCTGCTGTCTCT
>probe:Drosophila_2:1632723_at:550:119; Interrogation_Position=185; Antisense; AGCTGCTGTCTCTGTGGGAGTCCAA
>probe:Drosophila_2:1632723_at:360:517; Interrogation_Position=198; Antisense; GTGGGAGTCCAAGGCGAAGTTCTTC
>probe:Drosophila_2:1632723_at:46:375; Interrogation_Position=213; Antisense; GAAGTTCTTCGATGCCTGCGTCATC
>probe:Drosophila_2:1632723_at:368:647; Interrogation_Position=233; Antisense; TCATCTCGAAGCTTCAGTCACCGGA
>probe:Drosophila_2:1632723_at:513:495; Interrogation_Position=249; Antisense; GTCACCGGACTCGTCAATGCAGGAG
>probe:Drosophila_2:1632723_at:410:227; Interrogation_Position=334; Antisense; AAGGCGACTTTGGATAACTATCAGA
>probe:Drosophila_2:1632723_at:384:481; Interrogation_Position=370; Antisense; GTATTTATCCAACATGCTAGCCAGC
>probe:Drosophila_2:1632723_at:726:105; Interrogation_Position=38; Antisense; AGAACAGCCTCGAGAACGTCGTCAT
>probe:Drosophila_2:1632723_at:446:193; Interrogation_Position=52; Antisense; AACGTCGTCATTCCGATGTTCTGCA
>probe:Drosophila_2:1632723_at:587:283; Interrogation_Position=72; Antisense; CTGCAGCGCCGACTTGAGTATGTAT
>probe:Drosophila_2:1632723_at:714:429; Interrogation_Position=87; Antisense; GAGTATGTATTTCCACTTCGATCCA

Paste this into a BLAST search page for me
ACTTCGATCCATTCCTTTACGGATTTTTCTAATAGTGTTATCCTCGCCCAAGAAGCTAGCCAAGCTGCTGTCTCTAGCTGCTGTCTCTGTGGGAGTCCAAGTGGGAGTCCAAGGCGAAGTTCTTCGAAGTTCTTCGATGCCTGCGTCATCTCATCTCGAAGCTTCAGTCACCGGAGTCACCGGACTCGTCAATGCAGGAGAAGGCGACTTTGGATAACTATCAGAGTATTTATCCAACATGCTAGCCAGCAGAACAGCCTCGAGAACGTCGTCATAACGTCGTCATTCCGATGTTCTGCACTGCAGCGCCGACTTGAGTATGTATGAGTATGTATTTCCACTTCGATCCA

Full Affymetrix probeset data:

Annotations for 1632723_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720