Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632724_at:

>probe:Drosophila_2:1632724_at:703:421; Interrogation_Position=2403; Antisense; GAGCAATGCCCAGAAAGCAGCACGA
>probe:Drosophila_2:1632724_at:264:121; Interrogation_Position=2441; Antisense; AGCGTATTTGCAACGCATTGCCCTG
>probe:Drosophila_2:1632724_at:204:297; Interrogation_Position=2454; Antisense; CGCATTGCCCTGTATTGTCATCAAA
>probe:Drosophila_2:1632724_at:620:383; Interrogation_Position=2526; Antisense; GAACTTATAGTTTCTGGGCTGGACA
>probe:Drosophila_2:1632724_at:375:333; Interrogation_Position=2543; Antisense; GCTGGACAGCGCTACATCGTTAATT
>probe:Drosophila_2:1632724_at:411:537; Interrogation_Position=2606; Antisense; GGTAAAGTACTCATATGTGGCATCA
>probe:Drosophila_2:1632724_at:420:565; Interrogation_Position=2644; Antisense; GGCAAGGAACAGTGTCTTCTCCAAT
>probe:Drosophila_2:1632724_at:227:267; Interrogation_Position=2653; Antisense; CAGTGTCTTCTCCAATTGTTGTATG
>probe:Drosophila_2:1632724_at:327:81; Interrogation_Position=2735; Antisense; ACGGGCCAAAGTTCGCAAGGGATCT
>probe:Drosophila_2:1632724_at:253:541; Interrogation_Position=2768; Antisense; GGTTCAAAACCCTATACATGCATTA
>probe:Drosophila_2:1632724_at:676:703; Interrogation_Position=2790; Antisense; TTATCTGAATTCCAGAGTCCTGCTG
>probe:Drosophila_2:1632724_at:249:101; Interrogation_Position=2803; Antisense; AGAGTCCTGCTGACGCTGTTTAAAA
>probe:Drosophila_2:1632724_at:306:239; Interrogation_Position=2878; Antisense; AATCATTGCGTTTATCTCTGGTTAT
>probe:Drosophila_2:1632724_at:88:31; Interrogation_Position=2959; Antisense; ATAACTCTAATCGACCCCATATAAT

Paste this into a BLAST search page for me
GAGCAATGCCCAGAAAGCAGCACGAAGCGTATTTGCAACGCATTGCCCTGCGCATTGCCCTGTATTGTCATCAAAGAACTTATAGTTTCTGGGCTGGACAGCTGGACAGCGCTACATCGTTAATTGGTAAAGTACTCATATGTGGCATCAGGCAAGGAACAGTGTCTTCTCCAATCAGTGTCTTCTCCAATTGTTGTATGACGGGCCAAAGTTCGCAAGGGATCTGGTTCAAAACCCTATACATGCATTATTATCTGAATTCCAGAGTCCTGCTGAGAGTCCTGCTGACGCTGTTTAAAAAATCATTGCGTTTATCTCTGGTTATATAACTCTAATCGACCCCATATAAT

Full Affymetrix probeset data:

Annotations for 1632724_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime