FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632725_at:

>probe:Drosophila_2:1632725_at:309:661; Interrogation_Position=1017; Antisense; TAACTTTATTGGGACGCTCCCTTCG
>probe:Drosophila_2:1632725_at:67:633; Interrogation_Position=1034; Antisense; TCCCTTCGAGGGTCTTCAATCAAAT
>probe:Drosophila_2:1632725_at:351:239; Interrogation_Position=463; Antisense; AATCAAAGACGTACTGGTGCATCCA
>probe:Drosophila_2:1632725_at:409:203; Interrogation_Position=521; Antisense; AAGCGGCCTGGTGTGGATTACTTTC
>probe:Drosophila_2:1632725_at:324:461; Interrogation_Position=536; Antisense; GATTACTTTCTTCAGCAGTGCAGTC
>probe:Drosophila_2:1632725_at:498:445; Interrogation_Position=620; Antisense; GATGCTTTAGATCCCTATGGCTACA
>probe:Drosophila_2:1632725_at:157:497; Interrogation_Position=687; Antisense; GTCAGCATACCAAGAACCTCGATTA
>probe:Drosophila_2:1632725_at:679:153; Interrogation_Position=717; Antisense; ACAGGGATCTGAGCCGTGTGATAGT
>probe:Drosophila_2:1632725_at:2:85; Interrogation_Position=739; Antisense; AGTGGTGGACTGTGATCCGTATACC
>probe:Drosophila_2:1632725_at:127:307; Interrogation_Position=769; Antisense; CCTGCATCCCGATAATAGCTTGGTG
>probe:Drosophila_2:1632725_at:153:445; Interrogation_Position=818; Antisense; GATGATGTCCAGCTCTTTGATCTCA
>probe:Drosophila_2:1632725_at:290:571; Interrogation_Position=844; Antisense; GGCTTTCCTGCAGTTGATTGCCGAA
>probe:Drosophila_2:1632725_at:202:455; Interrogation_Position=900; Antisense; GATACTATCGCCAATTCGAGGACCC
>probe:Drosophila_2:1632725_at:534:73; Interrogation_Position=939; Antisense; AGGACAACCAACGTCGACTGCAGGA

Paste this into a BLAST search page for me
TAACTTTATTGGGACGCTCCCTTCGTCCCTTCGAGGGTCTTCAATCAAATAATCAAAGACGTACTGGTGCATCCAAAGCGGCCTGGTGTGGATTACTTTCGATTACTTTCTTCAGCAGTGCAGTCGATGCTTTAGATCCCTATGGCTACAGTCAGCATACCAAGAACCTCGATTAACAGGGATCTGAGCCGTGTGATAGTAGTGGTGGACTGTGATCCGTATACCCCTGCATCCCGATAATAGCTTGGTGGATGATGTCCAGCTCTTTGATCTCAGGCTTTCCTGCAGTTGATTGCCGAAGATACTATCGCCAATTCGAGGACCCAGGACAACCAACGTCGACTGCAGGA

Full Affymetrix probeset data:

Annotations for 1632725_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720