FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632726_at:

>probe:Drosophila_2:1632726_at:243:177; Interrogation_Position=1032; Antisense; AAACGTGGGCCATGCGGCATACGAT
>probe:Drosophila_2:1632726_at:522:683; Interrogation_Position=1110; Antisense; TATGCGATCCCAGAAGCCAGTTTGC
>probe:Drosophila_2:1632726_at:507:313; Interrogation_Position=1125; Antisense; GCCAGTTTGCCTTAAAGCCACAGTT
>probe:Drosophila_2:1632726_at:415:419; Interrogation_Position=1176; Antisense; GAGCATCTTTCTTGGTATGTCGTAT
>probe:Drosophila_2:1632726_at:69:33; Interrogation_Position=1199; Antisense; ATAAGTTTTTCTGCGCTGTGAGGAC
>probe:Drosophila_2:1632726_at:526:595; Interrogation_Position=643; Antisense; TGTGGATCCATTGCCGGTGACCTAA
>probe:Drosophila_2:1632726_at:597:655; Interrogation_Position=665; Antisense; TAATGATCTTCGCTGTGGTCCTGCA
>probe:Drosophila_2:1632726_at:666:223; Interrogation_Position=780; Antisense; AAGGAAGTTGCAGTCCCTAGTCGCC
>probe:Drosophila_2:1632726_at:288:459; Interrogation_Position=814; Antisense; GATATACTTCGACTCACTGATCTGA
>probe:Drosophila_2:1632726_at:345:79; Interrogation_Position=845; Antisense; AGGTCTTTGGAATTCCCTTGTTGCT
>probe:Drosophila_2:1632726_at:319:179; Interrogation_Position=870; Antisense; AAACTTTATTGCATCTGCGCTGCTG
>probe:Drosophila_2:1632726_at:397:445; Interrogation_Position=954; Antisense; GATGCTATTTCTGATTTCCGTACTG
>probe:Drosophila_2:1632726_at:299:19; Interrogation_Position=967; Antisense; ATTTCCGTACTGCTTGAGGTCTATC
>probe:Drosophila_2:1632726_at:474:693; Interrogation_Position=995; Antisense; TTTGCTCCTTCAGCCAGAGGTTAAT

Paste this into a BLAST search page for me
AAACGTGGGCCATGCGGCATACGATTATGCGATCCCAGAAGCCAGTTTGCGCCAGTTTGCCTTAAAGCCACAGTTGAGCATCTTTCTTGGTATGTCGTATATAAGTTTTTCTGCGCTGTGAGGACTGTGGATCCATTGCCGGTGACCTAATAATGATCTTCGCTGTGGTCCTGCAAAGGAAGTTGCAGTCCCTAGTCGCCGATATACTTCGACTCACTGATCTGAAGGTCTTTGGAATTCCCTTGTTGCTAAACTTTATTGCATCTGCGCTGCTGGATGCTATTTCTGATTTCCGTACTGATTTCCGTACTGCTTGAGGTCTATCTTTGCTCCTTCAGCCAGAGGTTAAT

Full Affymetrix probeset data:

Annotations for 1632726_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720