FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632727_at:

>probe:Drosophila_2:1632727_at:365:523; Interrogation_Position=1013; Antisense; GGGCTCCGTTAAACCAATGGTCCAG
>probe:Drosophila_2:1632727_at:463:393; Interrogation_Position=1041; Antisense; GAAATCGAGAATCAGGACGTCCCTT
>probe:Drosophila_2:1632727_at:125:557; Interrogation_Position=1055; Antisense; GGACGTCCCTTATCAAGACTCATAT
>probe:Drosophila_2:1632727_at:121:405; Interrogation_Position=1071; Antisense; GACTCATATCTTCGGATCGTGCGAT
>probe:Drosophila_2:1632727_at:483:31; Interrogation_Position=1159; Antisense; ATAACATGGGCTTTTATCGCGAGCA
>probe:Drosophila_2:1632727_at:532:615; Interrogation_Position=1211; Antisense; TGAATCTAGACGACCTACCGAGCGG
>probe:Drosophila_2:1632727_at:493:673; Interrogation_Position=1226; Antisense; TACCGAGCGGAACTGCTTCAACAGA
>probe:Drosophila_2:1632727_at:451:187; Interrogation_Position=1245; Antisense; AACAGATGTCACCAGTGTACCCCGA
>probe:Drosophila_2:1632727_at:547:267; Interrogation_Position=1293; Antisense; CATTTGACCTCCTTATATCGCAATC
>probe:Drosophila_2:1632727_at:33:615; Interrogation_Position=871; Antisense; TGAAGGGCACCTCCTACTTGCTGAT
>probe:Drosophila_2:1632727_at:269:57; Interrogation_Position=927; Antisense; ATGACCTGCCTTATGCTGTTGATGC
>probe:Drosophila_2:1632727_at:678:305; Interrogation_Position=952; Antisense; CCTGGCCGGAACTTTTGACTGTAAT
>probe:Drosophila_2:1632727_at:473:491; Interrogation_Position=972; Antisense; GTAATACGCTGGCTCAAAACCCTAT
>probe:Drosophila_2:1632727_at:300:255; Interrogation_Position=986; Antisense; CAAAACCCTATACGCTTGCTACAAA

Paste this into a BLAST search page for me
GGGCTCCGTTAAACCAATGGTCCAGGAAATCGAGAATCAGGACGTCCCTTGGACGTCCCTTATCAAGACTCATATGACTCATATCTTCGGATCGTGCGATATAACATGGGCTTTTATCGCGAGCATGAATCTAGACGACCTACCGAGCGGTACCGAGCGGAACTGCTTCAACAGAAACAGATGTCACCAGTGTACCCCGACATTTGACCTCCTTATATCGCAATCTGAAGGGCACCTCCTACTTGCTGATATGACCTGCCTTATGCTGTTGATGCCCTGGCCGGAACTTTTGACTGTAATGTAATACGCTGGCTCAAAACCCTATCAAAACCCTATACGCTTGCTACAAA

Full Affymetrix probeset data:

Annotations for 1632727_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720