Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632728_at:

>probe:Drosophila_2:1632728_at:325:413; Interrogation_Position=5155; Antisense; GACCAGCCAGTAGTGTAAGCTCGAA
>probe:Drosophila_2:1632728_at:377:395; Interrogation_Position=5202; Antisense; GAAATTCTACTTAACTGGCTGCCCT
>probe:Drosophila_2:1632728_at:433:279; Interrogation_Position=5225; Antisense; CTCCGTGCCATTAACACTTTTGTTT
>probe:Drosophila_2:1632728_at:109:485; Interrogation_Position=5278; Antisense; GTATGTTTCTGTATCCATTTCAAAT
>probe:Drosophila_2:1632728_at:450:385; Interrogation_Position=5309; Antisense; GAACTTATTTCTATTCTGCCAATTT
>probe:Drosophila_2:1632728_at:84:369; Interrogation_Position=5337; Antisense; GAATGCCTTTCTAGTGGAAGCTCTC
>probe:Drosophila_2:1632728_at:210:563; Interrogation_Position=5352; Antisense; GGAAGCTCTCATTCATAAACACATA
>probe:Drosophila_2:1632728_at:601:165; Interrogation_Position=5402; Antisense; AAATCCATACTAAAGCTGTTCGCTC
>probe:Drosophila_2:1632728_at:214:207; Interrogation_Position=5414; Antisense; AAGCTGTTCGCTCCTAAGTCAAAAG
>probe:Drosophila_2:1632728_at:70:485; Interrogation_Position=5500; Antisense; GTATCCGAACTTTCTTGCACTTCGA
>probe:Drosophila_2:1632728_at:267:243; Interrogation_Position=5615; Antisense; AATTTATTTATACAGCTGACGGTCA
>probe:Drosophila_2:1632728_at:657:75; Interrogation_Position=5643; Antisense; AGGTGAATCTTCATCCAATATTTTA
>probe:Drosophila_2:1632728_at:131:559; Interrogation_Position=5686; Antisense; GGACAACATTTTTTAGCCTACAATA
>probe:Drosophila_2:1632728_at:216:477; Interrogation_Position=5720; Antisense; GTTTTGAAGGCGTCTTTTCGCAGAC

Paste this into a BLAST search page for me
GACCAGCCAGTAGTGTAAGCTCGAAGAAATTCTACTTAACTGGCTGCCCTCTCCGTGCCATTAACACTTTTGTTTGTATGTTTCTGTATCCATTTCAAATGAACTTATTTCTATTCTGCCAATTTGAATGCCTTTCTAGTGGAAGCTCTCGGAAGCTCTCATTCATAAACACATAAAATCCATACTAAAGCTGTTCGCTCAAGCTGTTCGCTCCTAAGTCAAAAGGTATCCGAACTTTCTTGCACTTCGAAATTTATTTATACAGCTGACGGTCAAGGTGAATCTTCATCCAATATTTTAGGACAACATTTTTTAGCCTACAATAGTTTTGAAGGCGTCTTTTCGCAGAC

Full Affymetrix probeset data:

Annotations for 1632728_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime