FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632729_at:

>probe:Drosophila_2:1632729_at:30:77; Interrogation_Position=509; Antisense; AGGATCTCAGTGCTCCCCGAAGAGA
>probe:Drosophila_2:1632729_at:537:423; Interrogation_Position=530; Antisense; GAGATAACGTCTCCCAAACGGCCAT
>probe:Drosophila_2:1632729_at:674:175; Interrogation_Position=545; Antisense; AAACGGCCATTGACATGCTTGCCCA
>probe:Drosophila_2:1632729_at:187:121; Interrogation_Position=581; Antisense; AGCGTAAGCGATCTGTCCTGGAGTT
>probe:Drosophila_2:1632729_at:3:589; Interrogation_Position=599; Antisense; TGGAGTTGGTCCTCAAGCGCTGCGA
>probe:Drosophila_2:1632729_at:68:39; Interrogation_Position=623; Antisense; ATCTCGATCTGATTCGGGCCATTGA
>probe:Drosophila_2:1632729_at:599:725; Interrogation_Position=644; Antisense; TTGAGAATGTCTCGCCCACTGGCAA
>probe:Drosophila_2:1632729_at:112:85; Interrogation_Position=678; Antisense; AGTGGATGTCACCAGCAACCAGTTG
>probe:Drosophila_2:1632729_at:519:75; Interrogation_Position=710; Antisense; AGGAGCCGGGCATGTTGACCACTAT
>probe:Drosophila_2:1632729_at:170:315; Interrogation_Position=763; Antisense; GCCTTTAGGCCCGTGATAACAGATC
>probe:Drosophila_2:1632729_at:595:591; Interrogation_Position=806; Antisense; TGGTGGAGCTAAAGCCGCCGGTCTT
>probe:Drosophila_2:1632729_at:544:455; Interrogation_Position=873; Antisense; GTACCCCAAGTGGTTTGTGCCGCTA
>probe:Drosophila_2:1632729_at:75:683; Interrogation_Position=896; Antisense; TATCCTTTCCGGTGACCATGGGTCA
>probe:Drosophila_2:1632729_at:205:249; Interrogation_Position=954; Antisense; CAATTGCGCCTGCTTGGACAGCTAC

Paste this into a BLAST search page for me
AGGATCTCAGTGCTCCCCGAAGAGAGAGATAACGTCTCCCAAACGGCCATAAACGGCCATTGACATGCTTGCCCAAGCGTAAGCGATCTGTCCTGGAGTTTGGAGTTGGTCCTCAAGCGCTGCGAATCTCGATCTGATTCGGGCCATTGATTGAGAATGTCTCGCCCACTGGCAAAGTGGATGTCACCAGCAACCAGTTGAGGAGCCGGGCATGTTGACCACTATGCCTTTAGGCCCGTGATAACAGATCTGGTGGAGCTAAAGCCGCCGGTCTTGTACCCCAAGTGGTTTGTGCCGCTATATCCTTTCCGGTGACCATGGGTCACAATTGCGCCTGCTTGGACAGCTAC

Full Affymetrix probeset data:

Annotations for 1632729_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720