FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632730_at:

>probe:Drosophila_2:1632730_at:463:215; Interrogation_Position=299; Antisense; AAGATACCCTACACAGCCGAAGAGT
>probe:Drosophila_2:1632730_at:671:91; Interrogation_Position=421; Antisense; AGTTCTTCTGGAGTTCAAGGCCCGC
>probe:Drosophila_2:1632730_at:433:673; Interrogation_Position=471; Antisense; TATCGACCATCGTTTTTACCTCGTA
>probe:Drosophila_2:1632730_at:255:153; Interrogation_Position=495; Antisense; ACATCCACATGGACGGCTCGGAGAT
>probe:Drosophila_2:1632730_at:385:427; Interrogation_Position=515; Antisense; GAGATCTCCGGCTACATAGACCTGG
>probe:Drosophila_2:1632730_at:559:677; Interrogation_Position=531; Antisense; TAGACCTGGACATGAGCTGGCGCAA
>probe:Drosophila_2:1632730_at:131:361; Interrogation_Position=649; Antisense; GAATCCCCGGTATAACGTGGTCAAG
>probe:Drosophila_2:1632730_at:173:661; Interrogation_Position=688; Antisense; TAACTACCAGGTGATGCACGACCAT
>probe:Drosophila_2:1632730_at:704:59; Interrogation_Position=725; Antisense; ATGTTCATGCATCGCGGTGACCACA
>probe:Drosophila_2:1632730_at:530:183; Interrogation_Position=749; Antisense; AAAATGATTTCGGTGGGCGGCCAGT
>probe:Drosophila_2:1632730_at:241:331; Interrogation_Position=765; Antisense; GCGGCCAGTTCAACATTTACTCGAG
>probe:Drosophila_2:1632730_at:640:199; Interrogation_Position=791; Antisense; AACGCCAAGCGATCGATGGTCTACT
>probe:Drosophila_2:1632730_at:211:537; Interrogation_Position=808; Antisense; GGTCTACTCTCCCAAGTTCGGGTAT
>probe:Drosophila_2:1632730_at:261:645; Interrogation_Position=840; Antisense; TCTACGATCACTTTGTCCGCAAGAA

Paste this into a BLAST search page for me
AAGATACCCTACACAGCCGAAGAGTAGTTCTTCTGGAGTTCAAGGCCCGCTATCGACCATCGTTTTTACCTCGTAACATCCACATGGACGGCTCGGAGATGAGATCTCCGGCTACATAGACCTGGTAGACCTGGACATGAGCTGGCGCAAGAATCCCCGGTATAACGTGGTCAAGTAACTACCAGGTGATGCACGACCATATGTTCATGCATCGCGGTGACCACAAAAATGATTTCGGTGGGCGGCCAGTGCGGCCAGTTCAACATTTACTCGAGAACGCCAAGCGATCGATGGTCTACTGGTCTACTCTCCCAAGTTCGGGTATTCTACGATCACTTTGTCCGCAAGAA

Full Affymetrix probeset data:

Annotations for 1632730_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720