FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632731_at:

>probe:Drosophila_2:1632731_at:645:35; Interrogation_Position=2394; Antisense; ATCATAGTGCATGTGGATCCCTCGA
>probe:Drosophila_2:1632731_at:654:99; Interrogation_Position=2423; Antisense; AGAGGAAGCCTCCAATCAGCGCTTG
>probe:Drosophila_2:1632731_at:35:479; Interrogation_Position=2484; Antisense; GTTTACATTTGTCACGAGCGAGCTT
>probe:Drosophila_2:1632731_at:327:325; Interrogation_Position=2501; Antisense; GCGAGCTTGTCGAATGCCAGTTACC
>probe:Drosophila_2:1632731_at:305:469; Interrogation_Position=2520; Antisense; GTTACCGATCCGCAGCAGCTAGAGG
>probe:Drosophila_2:1632731_at:656:201; Interrogation_Position=2547; Antisense; AACCTAATGGCGTATTTCTTCTCAA
>probe:Drosophila_2:1632731_at:263:169; Interrogation_Position=2706; Antisense; AAAGACCCCAATAGACTTGCGACTC
>probe:Drosophila_2:1632731_at:612:325; Interrogation_Position=2724; Antisense; GCGACTCCAGCTTATTTCACTGTTA
>probe:Drosophila_2:1632731_at:61:89; Interrogation_Position=2749; Antisense; AGTCTGAGAGACTGCATTGCTCCCT
>probe:Drosophila_2:1632731_at:127:345; Interrogation_Position=2762; Antisense; GCATTGCTCCCTAAGTGTCTAGAGT
>probe:Drosophila_2:1632731_at:284:463; Interrogation_Position=2795; Antisense; GTTGTTGTACAAAGGCCCCTCTTCT
>probe:Drosophila_2:1632731_at:608:577; Interrogation_Position=2808; Antisense; GGCCCCTCTTCTTATTTTCATGGTA
>probe:Drosophila_2:1632731_at:217:267; Interrogation_Position=2854; Antisense; TGCAAGGTTCTCTCCAGTTTAAAAC
>probe:Drosophila_2:1632731_at:443:705; Interrogation_Position=2872; Antisense; TTAAAACCTATCATACCCATCCATT

Paste this into a BLAST search page for me
ATCATAGTGCATGTGGATCCCTCGAAGAGGAAGCCTCCAATCAGCGCTTGGTTTACATTTGTCACGAGCGAGCTTGCGAGCTTGTCGAATGCCAGTTACCGTTACCGATCCGCAGCAGCTAGAGGAACCTAATGGCGTATTTCTTCTCAAAAAGACCCCAATAGACTTGCGACTCGCGACTCCAGCTTATTTCACTGTTAAGTCTGAGAGACTGCATTGCTCCCTGCATTGCTCCCTAAGTGTCTAGAGTGTTGTTGTACAAAGGCCCCTCTTCTGGCCCCTCTTCTTATTTTCATGGTATGCAAGGTTCTCTCCAGTTTAAAACTTAAAACCTATCATACCCATCCATT

Full Affymetrix probeset data:

Annotations for 1632731_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720